Notum Promotes Proliferation and Migration of Oral Squamous Cell Carcinoma Via Shh/p-GSK3β/β-Catenin Pathway

doi:10.21203/rs.3.rs-957503/v1

Download PDF

Research

Notum Promotes Proliferation and Migration of Oral Squamous Cell Carcinoma Via Shh/p-GSK3β/β-Catenin Pathway

https://doi.org/10.21203/rs.3.rs-957503/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck, accounting for more than 90% of oral and maxillofacial malignancies. Therefore, it is of great importance to explore the key factors regulating OSCC. Notum belongs to the α/β hydrolase family and is a deacylated extracellular protein that regulates Wnt and other signaling pathways. Studies have found that Notum participates in the progression of colorectal cancer and hepatocellular carcinoma and targeting Notum can regulate the occurrence of cancer. However, the relationship between Notum and OSCC is currently unclear. This study aims to explore the role of Notum in regulating OSCC and its specific mechanism.

Methods: Nine OSCC tissue sections were selected for hematoxylin and eosin staining and immunohistochemistry for PCNA and Notum. Bioinformatics analysis was used to explore the correlation between OSCC and Notum expression. CCK8, Western blot, RT-PCR, scratch experiment, transwell, clone formation, flow cytometry, cellular immunofluorescence and in vivo nude mouse tumor formation methods were applied to OSCC cells treated with Notum human recombinant protein, a Notum overexpression plasmid, and a Notum small interfering RNA to explore the mechanism of Notum in regulating OSCC.

Results: The results of immunohistochemistry and bioinformatics analysis showed that Notum was highly expressed in OSCC tissues. Notum human recombinant protein promoted the proliferation and migration of Cal-27 and SCC-15 cells; overexpression of Notum promoted the proliferation and migration of Cal-27 and SCC-15 cells; si-Notum can significantly inhibit proliferation and migration of Cal-27 and SCC-15 cells and promote their apoptosis. Western blot and RT-PCR results showed that si-Notum can inhibit the Hedgehog signaling pathway. In addition, Notum human recombinant protein can increase the phosphorylation level of GSK3β and promote the expression of β-catenin, thereby further regulating the biological behavior of OSCC.

Conclusions: Notum regulates the proliferation and migration of OSCC through Shh/p-GSK3β/β-catenin signaling pathway. Notum maybe an effective targets for the treatment of OSCC.

General Biochemistry

Molecular Biology

carcinoma

proliferation

immunohistochemistry

bioinformatics

hematoxylin

Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck, accounting for more than 90% of oral and maxillofacial malignancies [1–3]. OSCC is characterized by a high incidence of local invasive growth and cervical lymph node metastasis [4]. The occurrence and metastasis of tumors is a complex process and exploring the key factors in the development of OSCC is vital for developing targeted therapies and obtaining positive clinical outcomes.

Notum regulates Wnt signaling activity as a carboxylesterase by removing the palmitoleate portion of Wnts, where glypicans act as a scaffold [5]. The latest research shows that Notum is closely related to the occurrence and progression of cancer [6, 7]. However, there are no reports about regarding Notum in the occurrence and development of OSCC. Therefore, this study aims to explore the role of Notum in regulating the occurrence and development of OSCC and its specific mechanism.

The morphogenetic factor sonic hedgehog (Shh) regulates many developmental processes [8, 9]. In adults, the hedgehog signal is mainly static and is only activated physiologically during tissue maintenance and repair [10]. It is reported that in the process of tumor formation and development, hedgehog signal dysregulation often occurs, and is harmful [11, 12]. Studies have shown that the regulation of hedgehog signaling can affect the progression of tumors [13, 14]. The results of our previous bioinformatic analysis showed that Notum and Shh expression are correlated in OSCC tissues. Therefore, we suspected that the interaction between Notum and Shh may be involved in the pathogenesis of OSCC.

In addition, our previous study also found that the Notum and β-catenin were highly expressed in OSCC tissues. And other study demonstrated that β-catenin was regulated by TCF/LEF transcription factors to activate and regulate target genes to impact cell proliferation and migration in cancer [15]. Therefore, Notum maybe participates in OSCC progress by regulating β-catenin. Previous research has shown that in (HCC), there is cross talk between the Shh signaling pathway and the Wnt/β-catenin signaling pathway, which is involved in regulating HCC progression [16]. However, this mechanism has not been fully elucidated, especially in the pathogenesis of OSCC. Therefore, we suspected that Notum may regulate β-catenin through cross talk between Shh and Wnt/β-catenin signaling pathways, thereby further promoting the progression of OSCC.

In our experiments, we hope to clarify the influence of Notum on the behavior of OSCC and explore its mechanism of the regulation of OSCC.

Human tissue samples

The paraffin tissue sections of nine OSCC patients came from the Department of Pathology, Shandong Provincial Stomatological Hospital. All patients in this study were diagnosed by pathology, and no other treatments, such as radiotherapy or chemotherapy, were performed before surgery. The study has been approved by the Bioethics Committee of Shandong Stomatological Hospital (Approval No. 20201105) and all patients provided informed consent.

Hematoxylin and eosin (HE) staining and Immunohistochemical (IHC) staining

After dewaxing and hydration, the sections were soaked in hematoxylin dye for 15 minutes. Subsequently, the sections were stained with eosin dye for 7 minutes. Then the sections were dehydrated with an ascending alcohol concentration gradient, soaked in xylene solution twice, and then mounted with neutral gum. In order to IHC staining, the sections were incubated with 0.3% hydrogen peroxide for 30 minutes at room temperature, the dewaxed paraffin sections were pre-treated with 1% bovine serum albumin in phosphate-buffered saline (BSA-PBS) for 20 minutes at room temperature. Next, the sections were treated with primary antibody (anti-PCNA, abcam92552, 1:100; anti-Notum,abcam106448, 1:100; anti-Shh, ab53281, 1:100; anti-β-catenin, ab32572, 1:100) in BSA-PBS at room temperature. Two hours later, the sections were rinsed by PBS and treated with secondary antibody (goat anti-rabbit IgG H&L, abcam6721, 1:200) for 1 hour at room temperature. Diaminobenzidine (Sigma-Aldrich, MO, USA) was used as the substrate for immune complexes for visualization. Images were acquired and taken by an optical microscope (Olympus BX-53, Tokyo, Japan).

Bioinformatics analysis

The row count expression matrix of TCGA-HNSC cohort was obtained from GDC data portal (https://portal.gdc.cancer.gov/). The FPKM (log2 [FPKM+1]) expression matrix of TCGA-HNSC cohort was downloaded from UCSC Xena database (https://xenabrowser.net/). The patients whose anatomic neoplasm subdivisions are from oral cavity (including oral tongue, buccal mucosa, alveolar ridge, tonsil, base of tongue, floor of mouth, lip, hard palate, and oral cavity) were selected for our studies, which contain 305 OSCC samples, and 30 control samples. The R package “edgR” was used for differentially expressed gene (DEG) analysis and the cut-off values for DEGs were set as: FDR<0.05 and |log2FC|>1. According to the median expression of Notum, OSCC samples were divided into high Notum expression group and low Notum expression group and the gene enrichment analysis (GSEA) was performed by R package “ClusterProfiler” [17] to explore the biological function of Notum (HALLMARK gene-set). Protein-protein interaction (PPI) analysis of Notum was performed by STRING database (https://www.string-db.org/).

Cell culture

Human OSCC lines, Cal-27 and SCC-15, were obtained from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA), and 1% penicillin streptomycin at 37℃ in humidified atmosphere of 5% CO₂ and 95% air.

Transfection of Notum and Neutralize extracellular Notum

For overexpression, the pcDNA3.1-Notum and the empty pcDNA3.1 (negative controls) were purchase form Youbao Biology (G115588). The plasmid was transfected into Cal-27 or SCC-15 cells using Lipofectamine 2000 (ZC302, Zomanbio, China) according to manufacturer's protocol. For knockdown of Notum, three Notum-siRNAs and one siRNA for negative control (Ribobio, Guangzhou, China) were transfected by riboFECT^TMCP (C10511-05, Ribobio, Guangzhou, China) according to manufacturer's protocol. In order to neutralize the extracellular Notum, 10 µg/ml of palmitoleoyl-protein carboxylesterase (Notum) antibody (ab106448; Abcam, UK) and IgG antibody (ab171870, Abcam, UK) to Vector group and Notum overexpression groups respectively. Cells were incubated for a 24, 48, 72 hours.

Western blotting

All proteins are separated by RIPA lysis buffer (CW2333S, Kangwei,China), containing 1% phosphatase inhibitor and 1% protease inhibitor. The protein concentration was determined with BCA kit (P0010, Beyotime). 30µg of total protein was separated by 10% SDS-PAGE gel and transferred onto a 0.45 µm PVDF membrane. The membranes were immersed in a Tris-buffered saline Tween 20 solution with 5% BSA for 1 hour, and then incubated with primary antibodies at 4°C overnight including anti-Notum (ab106448, Abcam, UK), anti-GAPDH (10494-1-AP, Proteintech, USA), ant-Shh (ab53281, Abcam, UK), anti-β-catenin (ab32572, Abcam, UK), anti-GSK3β (12456T, Cell Signaling Technology, USA), anti-p-GSK3β (Ser9) (ab68476, Abcam, UK). The subsequent day, the sections were incubated with secondary antibody goat anti-rabbit (ab6721, Abcam, UK) at room temperature for 1 hour. Finally, the ECL detection system (Smart Chemi 420, Beijing, China) was used for immune reaction zone visualization. The membrane intensity was measured with Image J software.

Real-time quantitative polymerase chain reaction analysis

Total RNA was extracted with TRIzol reagent, and the cDNA was synthesized according to the reverse transcriptase product manual (Takara Bio, Shiga, Japan). The gene-specific primers targeted to Notum, PCNA, MMP2, MMP9, Bax, Bcl-2, GAPDH were synthesized commercially (AG Shanghai, China). The gene-specific primer sequences are listed in Table1. qRT-PCR was performed with the Roche Light Cycler^@ 96 SW using SYBR Premix Ex Taq (DRR820A, TaKaRa, China).

Table 1

Specific primers for control and target genes
Gene	Forward primer	Reverse Primer
Notum	CTACTGGTGGAACGCAAACATGG	CGCACCACCTCCTGGATGATG
PCNA	CGCCCTGGTTCTGGAGGTAA	GGCTGAGACTTGCGTAAGGG
MMP2	CTCATCGCAGATGCCTGGAA	TTCAGGTAATAGGCACCCCCCTTGAAGA
MMP9	CGCAGACATCGTCATCCAGT	GGACCACAACTCGTCATCGT
Shh Ptch1 Gli1	TCCAGAAACTCCGAGCGATTTA ACCAGAATGGGTCCACGACAA ACACATATGGACCTGGCTTTGGA	GTCACCCGCAGTTTCACTCC AAAGTCTGAGGTGTCCCGCAAG CTGCCCTATGTGAAGCCCTATTTG
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA

Enzyme linked immunosorbent assay

The cell supernatant was collected and the level of exogenous Notum was measured using ELISA kits (CSB-EL015955H,Cusibio, Wuhan, China) following to the manufacturer’s protocols.

Clone Formation Assay

Cells were seeded in 6-well plates at a density of 400 cells/well and cultured for 10 days. After fixation with 4 % paraformaldehyde for 15 minutes, sections were dyed with 0.1% crystal violet for 15 minutes. Only colonies that contained more than 50 cells were counted.

Cell Counting Kit-8 (CCK8)

Cell proliferation was assessed using CCK8 (MedChemExpress, China) according to the manufacturer's instruction. In brief, 10 µl of CCK8 solution was added to each well and the plates were incubated for an hour at 37°C. Optical density was acquired at 450 nm from a Bio-Rad microplate reader (Model 680, Bio-Rad, USA).

Wound-healing assay

Cells were transfected and after 48 hours incubation, replated to 6-well plates at a density of 4×10⁵ cells/well for 12 hours. A wound was generated using a pipette tip in each well. After 24 or 48 hours of culture, the wound closure was measured using Image J software.

Transwell

After 48 hours transfection, cells (3×10⁴ cells/well, in 100 µl serum-free medium) were added to the upper chamber of a 24-well plate in which the lower chamber contained 600 µl of culture medium with 10% FBS. After a period of 24 hours, we used cotton swabs to wipe out the cells that had not migrated through the membrane to the lower chamber. We fixed the migrated or invaded cells in 4% paraformaldehyde for 30 minutes, and then stained them with 0.1% crystal violet for another 20 minutes. The cells were photographed with a light microscope (Olympus BX53, 100 Tokyo, Japan) at magnification and counted for analysis.

Hoechst 33342/PI assay

After 48 hours transfection, cells (5×10³ cells/well) were added to a 24-well plate for 12 hours. Then the cells were co-stained with Hoechst 33342 (10 µg/mL; Beyotime, Shanghai, China) and PI (5 µg/mL; Beyotime) for 15 minutes. After rinsing with PBS three times, cell fluorescence was observed and captured under a fluorescence microscope.

Apoptosis Flow-Cytometry Assay

The Cal-27 and SCC-15 cells were placed in 6-well plates at 2×10⁵ cells per well. After transfection with siRNA for 48 hours, cell apoptosis was measured using FITC-AnnexinV Apoptosis Detection Kit (556547, BD Biosciences, China) following to the manufacturer’s protocols.

Cell immunofluorescence

Cells were fixed with 4% paraformaldehyde for 30 minutes and permeabilized with 0.1% Triton for 5 minutes. Blocking was performed with PBS containing 3% bovine serum albumin for 30 minutes. Cells were incubated with anti-Notum antibody overnight at 4°C in the dark. Then, the cells were rinsed and incubated with secondary antibodies anti rabbit FITC (SA00003-2, Proteintech, China). Afterwards, cells were stained with DAPI (ab104139, Abcam, UK) and observed under a fluorescence confocal microscope.

In vivo tumorigenicity assay

Eight SPF-grade BALB/c nu/nu male nude mice (6 weeks old) without a specific pathogen were used and this study was approved by the Bioethics Committee of Shandong Stomatological Hospital (Approval No. 20210711). After a week of adaptive feeding, the nude mice were randomly divided into negative control (NC) group and si-Notum group with four mice in each group. Then, 0.2 mL of NC and si-Notum SCC15 cell suspensions at a concentration of 5×10⁶ cells/mL were subcutaneously injected into the right back of each mouse. Tumor volumes (volume = length × width² /2) was measured every 3 days after injection. After 30 days, tumor formation was obvious and the mice were sacrificed. The tumors were removed and examined.

Statistical analysis

All data was analyzed at least three times and expressed as means ± standard deviations. Statistical analysis was performed using GraphPad Prism7 software (CA, USA). Differences between experimental and control groups were calculated using the Student t test. p value <0.05 indicated a statistically significant difference.

Notum is highly expressed in human OSCC tissues

The DEG analysis revealed that Notum was an aberrant gene significantly up-regulated in OSCC samples, including all OSCC and paired OSCC samples (Figure 1A-C). Western blot, RT-PCR and cell immunofluorescence results showed that Notum was expressed in both OSCC cells, and the expression of Notum is higher in SCC-15 cells than Cal-27 cells(Figure 1D, F, G, H). In addition, the ELISA results showed that the secretion of Notum from the SCC-15 cells was significantly increased compared with Cal-27 cells (Figure 1E). To explore the potential role of Notum in human OSCC tissue, we firstly collected nine cases of OSCC tissue sections and performed HE staining (Figure 2A). IHC staining showed PCNA and Notum were highly expressed in human OSCC tissues (Figure 2B, C).

Notum promotes the proliferation of OSCC cells

The results of CCK8 analysis showed that the Notum human recombinant protein promoted the cell viability of OSCC cells in a dose-dependent (0, 1, 2, 4µg/mL) and time-dependent manner (0, 24, 48, 72 hours) (Figure 3A). The Notum human recombinant protein promoted the expression of PCNA in OSCC cells in a dose-dependent manner (0, 2, 4µg/mL) by Western blot (Figure 3C, D) and RT-PCR (Figure 3E). To further confirm the effects of extracellular Notum and intracellular Notum on cell proliferation, pcDNA-Notum was transfected into OSCC cells for overexpression. Western blot,RT-PCR and ELISA analysis showed that Notum expression increased after transfecting pcDNA-Notum (Supplementary data 1A-E). After being transfected for 48 hours, CCK-8 assay showed that overexpression of Notum significantly increased the cell viability of OSCC cells at 72 hours. Compared with vector group and Notum overexpression groups, cell viability was also inhibited after adding anti-Notum in vector group and Notum overexpression groups (Figure 3B). RT-PCR suggested that the mRNA level of PCNA was consistent with CCK8 results (Figure 3F). In addition, we constructed three Notum si-RNAs. Quantification of gene transfer efficiency in OSCC cells was measured via proportion of fluorocytes (Supplementary Data 2A, B). RT-PCR showed that si-Notum-2 had the most effective interference and was used for subsequent experimental verification (Supplementary Data 2C). Colony forming assay consistently showed that knocking down Notum significantly inhibited the colony forming ability of OSCC cells (Figure 3G, H). The effect of knockdown Notum was further evaluated in an in vivo subcutaneous tumorigenesis model. Compared to the control group, Notum knockdown significantly reduced tumor size and tumor weight (Figure 3I-K).

Notum promotes the migration of OSCC cells

The wound-healing assay results showed that the Notum human recombinant protein promoted the migration ability of OSCC cells in a dose-dependent manner (0, 2, 4µg/mL)(Figure 4A-D). RT-PCR results showed that the Notum human recombinant protein promoted the increase of the mRNA levels of MMP2 and MMP9 expression in OSCC cells in a dose-dependent manner (0, 1, 2, 4µg/mL) (Figure 4E). RT-PCR suggested that overexpression of Notum increased the mRNA level of MMP2 and MMP9 compared with vector group while the mRNA levels of MMP2 and MMP9 were reduced in the anti-Notum group. Compared with Notum overexpression group, the mRNA level of MMP2 and MMP9 decreased after adding anti-Notum in Notum overexpression group (Figure 4F). Transwell results showed that knocking down Notum significantly decreased the number of migrating OSCC cells as compared to the control group (Figure 4G, H). RT-PCR results showed that knocking down Notum significantly decreased the mRNA levels of MMP2 and MMP9 in OSCC cells. These results suggested that Notum promotes the migration ability of OSCC cells (Figure 4I).

Notum knockdown promoted apoptosis of OSCC cells

To further explore the effect of knocking down Notum on human OSCC cell viability, Hoechst3342/PI and CCK8 assays were applied. After being transfected with si-Notum-2 for 48 hours, Hoechst3342/PI results showed that a significant increase in the percentage of necrotic cells was observed in si-Notum-2 cells group compared with the NC group (Figure 5A, B). CCK8 assay showed that knocking down Notum significantly inhibited proliferation of OSCC cells at 24, 48, 72 hours (Figure 5C). Western blot analysis found that the expression of Bax and cleave-caspase3 increased, while Bcl-2 expression decreased in si-Notum-2 group compared with NC group (Figure 5E, F). RT-PCR confirmed these results (Figure 5D). In addition, flow cytometry analysis suggested that knocking down Notum significantly led to increased apoptosis in OSCC cells compared with NC group (Figure 5G-J).

Notum regulates the proliferation and migration of OSCC through Shh

GSEA results suggested that Notum is closely related to tumorigenic biological behaviors or pathways, such as epithial to mesenchymal transition, hedgehog pathway and KRAS signaling (Figure 6A). PPI network analysis showed that Notum strongly interacted with SHH, IHH and DHH, indicating Notum may be involved in hedgehog signaling (Figure 6B). After infecting si-Notum-2 for 48 hours, Western blot analysis showed that the expression of Shh decreased compared with NC group (Figure 6D, E). RT-PCR analysis revealed that the mRNA level of Gli1, Ptch1 and Shh were reduced in si-Notum-2 group (Figure 6C). In addition, we also performed IHC staining for Shh on human OSCC tissues, and found that compared with normal tissues, Shh was highly expressed in OSCC tissues (Figure 6F). In order to explore the correlation between Notum and Shh in OSCC, we screened siRNAs against Shh for the most effective interference through RT-PCR. Results suggested si-Shh-1 for subsequent verification (Supplementary data 2D). RT-PCR analysis showed that knocking down Shh can significantly inhibit the increase in the mRNA levels of PCNA and MMP2 induced by the Notum human recombinant protein in OSCC cells (Figure 6G). In addition, it is interesting that the cell immunofluorescence results showed that compared with NC group, knocking down Shh inhibits the expression of Notum in OSCC cells (Figure 6H).

Notum regulates the proliferation and migration of OSCC axially through Shh/p-GSK3β/β-catenin

Because Notum is a Wnt lipase, it can negatively regulate the Wnt signaling pathway. Therefore, we assessed its impact on the important Wnt downstream target, β-catenin. We investigated three cases of patients with OSCC by RT-PCR analysis of tumor and adjacent tissues. However, the interesting results showed that the expression of Notum and β-catenin was positively correlated (Figure 7A). IHC staining results showed that β-catenin was highly expressed in OSCC tissues compared to normal tissues (Figure 7B). In order to further explore whether there is a correlation between Shh and the Wnt/β-catenin signaling pathway, the relation proteins were evaluated by Western blot following Shh knockdown. Western blot analysis suggested that Notum human recombinant protein promoted the expression of p-GSK3β/T-GSK3β and β-catenin protein compared with NC group. However, si-Shh-1 can inhibit the activation of Notum on Wnt/β-catenin signaling pathways (Figure 7C, D). These results indicate that Notum may further regulate the Wnt signaling pathway and participate in the progression of OSCC by targeting Shh. After being transfected with si-Notum-2 for 48 hours, GSK3β inactivator Licl was added and RT-PCR results showed that Licl can increase the mRNA level of PCNA and MMP2 in si-Notum-2 Cal-27 and SCC-15 cell groups (Figure 7E). Western blot analysis showed that Notum knockdown inhibits the phosphorylation of GSK3β (p-GSK3β) and the expression of β-catenin. However, Licl can increased the protein levels of p-GSK3β and β -catenin in OSCC cells compared with si-Notum-2 group (Figure 7F, G).

Notum is an evolutionarily-conserved, 56-kDa secreted deacylase that regulates Wnt signaling activity [18]. Its role in mammals has gradually been elucidated through deepening research [19]. Studies have shown that Notum is essential for the induction of nerves and head during vertebrate embryo development [20]. In addition, there is also research that Notum may be involved in HCC [6], colorectal cancer [7], and is also related to gastric cancer [21]. However, no one has explored the expression and mechanism of Notum in OSCC. IHC results showed that Notum and PCNA was highly expressed in human OSCC tissues. In vitro experiments also showed that Notum is highly expressed in OSCC cell lines. These results indicate that Notum may be involved in the development of OSCC. Study has shown that cell proliferation and migration are inhibited in Notum knockdown in colorectal cancer cells [7]. Therefore, we explored the effect of Notum on the proliferation and migration of OSCC cells. In our research, Notum human recombinant protein and overexpression of Notum can promote proliferation and migration in OSCC cells. Knockdown Notum inhibited cell viability and the expression of PCNA, MMP2, MMP9. The results in vivo also showed that knocking down Notum inhibits the size and weight of tumors. The above results indicated that Notum is involved in regulating the proliferation and migration of OSCC. What interesting is that adding anti-Notum can decrease the expression of PCNA, MMP2, and MMP9 in OSCC cells. These results indicated that Notum mainly acts as a secreted protein outside cells to regulate proliferation and migration in OSCC. In addition, apoptosis is also crucial for the development of cancer [22]. Therefore, this experiment also explored the regulatory effect of Notum on the apoptosis of OSCC cells. Among them, the balance of anti-apoptotic proteins and pro-apoptotic proteins is believed to determine whether the cell is alive or apoptotic [22]. Western blot, RT-PCR and Flow cytometry analysis results showed that knocking down Notum knocking down Notum increased the rate of apoptosis. These results indicated that Notum may regulate the progression of OSCC through apoptosis.

When we explored the mechanism of Notum in the regulation of OSCC, the results of bioinformatic analysis and STRING protein network interaction analysis found that Notum was correlated with the hedgehog signaling pathway. When Shh ligand binds to its receptor, protein PTCH 1 or 2, the Shh signaling pathway is activated. The combination of Hh ligand and PTCH weakens the inhibitory effect of SMO by promoting the translocation of SMO to the plasma membrane and makes SMO fully activated. The activation of SMO leads to the dissociation of the Gli-Sufu complex and the translocation of the Gli protein to the nucleus where it up-regulates the expression of target genes, including the anti-apoptotic gene and proliferation-related genes [23, 24]. In addition, the hedgehog pathway plays a key role in cancer. Alterations of Hh signaling pathway, causally linked to tumor progression, have become rational targets for cancer therapy [25]. RT-PCR results showed that knockdown of Notum can decrease the mRNA level of Shh, Ptch1, and Gli1, indicating that Notum may be involved in the regulation of OSCC through the Shh. Further, IHC results showed that Shh is highly expressed in human OSCC tissues. The above results indicated that Notum and Shh are correlated. According to previous research, Dally is the structure of the protein core of glypican, which is important for hedgehog signaling [26]. Loss of Dally in fruit flies results in defects in brain, eye, wings, antennae, and genitalia [27]. In the Hh-receiving cells, Notum plays a more autonomous role, and the modification of Dally in these cells appears to lead to a local activation of high hedgehog pathway signaling [28]. This also further verified our hypothesis. Cell immunofluorescence results also found that after knockdown Shh, the expression of Notum was also reduced in OSCC cells. However, the mechanism is still unclear. Research has shown that Notum is a novel target of β-catenin/TCF4 and is upregulated in Wnt/β-catenin signaling-activated HCC [6]. These results suggest that knockdown Shh may further participate in regulating Notum expression by regulating β-catenin, thereby regulating the proliferation and migration of OSCC cells.

As Notum is a negative regulator of Wnt signaling pathway, β-catenin is an important downstream target [29]. Therefore, it is important to explore the correlation between β-catenin and Notum in OSCC. Studies have shown that β-catenin is expressed in OSCC tissue [30]. However, its mechanism of action is unclear. Interestingly, in our study, the analysis of fresh tissues of patients showed that Notum and β-catenin were highly expressed in human OSCC tissues. In vitro experiments showed that knockdown Notum in OSCC cells reduced the expression of β-catenin and human recombinant Notum increased the expression of β-catenin in OSCC cells. These results indicated that Notum may be involved in the regulation of β-catenin expression. Since a correlation between Notum and the Shh was shown in our previous studies, we hypothesized that Notum might be regulate the Wnt signaling pathway through Shh. When the Wnt signaling pathway is active, Wnt ligands are bound to the receptor Frizzled, activating the disheveled protein, and enhancing the phosphorylation level of GSK3β, thereby inhibiting GSK3β and leading to the accumulation of β-catenin in the cytoplasm, and then transporting to the nucleus to participate in downstream regulation [31]. Study has shown that GSK3β can participate in a variety of cell signaling pathways to regulate cell proliferation, apoptosis and development [32]. Therefore, we hope to explore the important role of GSK3β in the regulation of β-catenin by Notum in the pathogenesis of OSCC. Our research results show that after adding of Notum human recombinant protein, the expression of p-GSK3β and β-catenin increases. Knockdown Shh can inhibit the proliferation and migration of OSCC cells induced by Notum human recombinant protein. At the same time, the p-GSK3β decreases and the degradation of β-catenin increases, thereby reducing the expression of β-catenin. These results indicate that knockdown Shh may be involved in regulating the proliferation and migration of OSCC cells by reducing the p-GSK3β and the expression of β-catenin. Our results also found that the p-GSK3β decreased after Notum knockdown, and the expression of β-catenin decreased in OSCC cells. After adding an inactivator of GSK3β (Licl), the inhibitory effect of Notum knockdown on the proliferation and migration of OSCC cells can be reversed. The above results all indicate that Notum may regulate the proliferation and migration of OSCC through Shh/p-GSK3β/β-catenin. However, this mechanism needs to be further confirmed by more in-depth exploration.

We have demonstrated that the high expression of Notum in OSCC is involved in regulating the progression of OSCC. It may regulate the proliferation and migration of OSCC via Shh/p-GSK3β/β-catenin pathway (Figure 8). These findings suggest that Notum can potentially be used as a valuable therapeutic target for OSCC patients.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Cell lines, si-RNAs, plasmids and other reagents described in this manuscript are available upon a reasonable request.

Acknowledgements

Not applicable

Funding

This work was partially supported by the National Natural Science Foundation of China (Grant No. 81972072) to M Li, the National Natural Science Foundation of China （Grant No. 81800982) to HR Liu and the Construction Engineering Special Fund of“Taishan Scholars”of Shandong Province (No. tsqn202103177) to HR Liu.

Ethics declarations

Ethical Approval and Consent to participate

All patients signed informed consent forms. This investigation involving human specimens was approved by the Bioethics Committee of Shandong Stomatological Hospital (Approval No. 20201105). All animal experiments were approved by the Bioethics Committee of Shandong Stomatological Hospital (Approval No. 20210711).

Consent for publication

Not applicable

Competing interests

The authors declare no competing interests.

Author’ contributons

PPY, CSL: conceptualization, methodology, writing—original draft; QZ, XQZ, YYK: investigation, writing—original draft; QSF, HW, RJS, HRL, TH: data curation, writing—reviewing; MQL: conceptualization, writing—reviewing and editing. All authors approved the final paper and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Parkin DM, et al. Estimating the world cancer burden: Globocan 2000. Int J Cancer. 2001;94(2):153–6.
Bray F, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.
Fitzmaurice C, et al. Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2016: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2018;4(11):1553–68.
Byers RM, et al. Can we detect or predict the presence of occult nodal metastases in patients with squamous carcinoma of the oral tongue? Head Neck. 1998;20(2):138–44.
Kakugawa S, et al. Notum deacylates Wnt proteins to suppress signalling activity. Nature. 2015;519(7542):187–92.
Torisu Y, et al. Human homolog of NOTUM, overexpressed in hepatocellular carcinoma, is regulated transcriptionally by beta-catenin/TCF. Cancer Sci. 2008;99(6):1139–46.
Yoon JH, et al. NOTUM Is Involved in the Progression of Colorectal Cancer. Cancer Genomics Proteomics. 2018;15(6):485–97.
Jessell TM. Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat Rev Genet. 2000;1(1):20–9.
Ingham PW, McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 2001;15(23):3059–87.
Beachy PA, Karhadkar SS, Berman DM. Tissue repair and stem cell renewal in carcinogenesis. Nature. 2004;432(7015):324–31.
Pasca di Magliano, M, Hebrok M. Hedgehog signalling in cancer formation and maintenance. Nat Rev Cancer. 2003;3(12):903–11.
Thayer SP, et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature. 2003;425(6960):851–6.
Qin H, et al. ZnRF3 induces apoptosis of gastric cancer cells by antagonizing Wnt and Hedgehog signaling. Panminerva Med. 2015;57(4):167–75.
Liu Y, et al. Dihydroartemisinin induces apoptosis and inhibits proliferation, migration, and invasion in epithelial ovarian cancer via inhibition of the hedgehog signaling pathway. Cancer Med. 2018;7(11):5704–15.
MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009;17(1):9–26.
Giakoustidis A, et al. Molecular signalling in hepatocellular carcinoma: Role of and crosstalk among WNT/ß-catenin, Sonic Hedgehog, Notch and Dickkopf-1. Can J Gastroenterol Hepatol. 2015;29(4):209–17.
Yu G, et al. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics. 2012;16(5):284–7.
Giráldez AJ, Copley RR, Cohen SM. HSPG modification by the secreted enzyme Notum shapes the Wingless morphogen gradient. Dev Cell. 2002;2(5):667–76.
Traister A, Shi W, Filmus J. Mammalian Notum induces the release of glypicans and other GPI-anchored proteins from the cell surface. Biochem J. 2008;410(3):503–11.
Zhang X, et al. Notum is required for neural and head induction via Wnt deacylation, oxidation, and inactivation. Dev Cell. 2015;32(6):719–30.
Madan B, et al. NOTUM is a potential pharmacodynamic biomarker of Wnt pathway inhibition. Oncotarget. 2016;7(11):12386–92.
Chang F, et al. Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: a target for cancer chemotherapy. Leukemia. 2003;17(3):590–603.
Ramsbottom SA, Pownall ME. Regulation of Hedgehog Signalling Inside and Outside the Cell. J Dev Biol. 2016;4(3):23.
Katoh Y, Katoh M. Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med. 2009;9(7):873–86.
Bissey PA, et al., Blocking SHH/Patched Interaction Triggers Tumor Growth Inhibition through Patched-Induced Apoptosis. 2020. 80(10): p. 1970–1980.
Kim MS, et al. Structure of the protein core of the glypican Dally-like and localization of a region important for hedgehog signaling. Proc Natl Acad Sci U S A. 2011;108(32):13112–7.
Tsuda M, et al. The cell-surface proteoglycan Dally regulates Wingless signalling in Drosophila. Nature. 1999;400(6741):276–80.
Ayers KL, et al. Dally and Notum regulate the switch between low and high level Hedgehog pathway signalling. Development. 2012;139(17):3168–79.
Liu LK, et al. Upregulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: correlation with the clinicopathological features and patient outcome. Mod Pathol. 2010;23(2):213–24.
Ahmad B, et al. Expression of Ki-67 and Βeta-Catenin in Pseudoepitheliomatous Hyperplasia and Squamous Cell Carcinoma in Oral Mucosal Biopsies: An Immunohistochemical Study. Asian Pac J Cancer Prev. 2020;21(1):157–61.
Li F, Chong ZZ, Maiese K. Winding through the WNT pathway during cellular development and demise. Histol Histopathol. 2006;21(1):103–24.
Takahashi-Yanaga F. Activator or inhibitor? GSK-3 as a new drug target. Biochem Pharmacol. 2013;86(2):191–9.

Supplementarydata1.tif
Supplementary data 1. The efficiency of Notum overexpression A, B, C, Notum expression in Notum overexpression OSCC cells was detected by western blot analysis. D, E, ELISA analysis of Notum expression in Notum overexpression OSCC cells. The results are shown as the mean ± SD (n = 3), ns, non-significant difference；* p<0.05; ** p<0.01; *** p<0.001.
Supplementarydata2.tif
Supplementary data 2. Screen the most effective si-Notum and si-Shh in OSCC cells A, B, Fluorescent si-RNA to detect cell transfection efficiency. The scale bar was 500 μm. C, RT-PCR analysis screens si-Notum efficiency. D, RT-PCR analysis screens si-Shh efficiency. The results are shown as the mean ± SD (n= 3), ns, non-significant difference；* p<0.05; ** p<0.01; *** p<0.001.

Download PDF

Version 1

posted

You are reading this latest preprint version

Notum Promotes Proliferation and Migration of Oral Squamous Cell Carcinoma Via Shh/p-GSK3β/β-Catenin Pathway

Status:

Version 1

Abstract

Figures

Background

Methods

Human tissue samples

Hematoxylin and eosin (HE) staining and Immunohistochemical (IHC) staining

Bioinformatics analysis

Cell culture

Transfection of Notum and Neutralize extracellular Notum

Western blotting

Real-time quantitative polymerase chain reaction analysis

Enzyme linked immunosorbent assay

Clone Formation Assay

Cell Counting Kit-8 (CCK8)

Wound-healing assay

Transwell

Hoechst 33342/PI assay

Apoptosis Flow-Cytometry Assay

Cell immunofluorescence

In vivo tumorigenicity assay

Statistical analysis

Results

Notum is highly expressed in human OSCC tissues

Notum promotes the proliferation of OSCC cells

Notum promotes the migration of OSCC cells

Notum knockdown promoted apoptosis of OSCC cells

Notum regulates the proliferation and migration of OSCC through Shh

Notum regulates the proliferation and migration of OSCC axially through Shh/p-GSK3β/β-catenin

Discussion

Conclusions

Declarations

References

Supplementary Files

Status:

Version 1