Plasmids, cell culture, transfection, stable cell line, and minigene reporter assays
KDM4B plasmids were described previously (27). human PCa cell line LNCaP, VCaP, and 22Rv1 were purchased from ATCC (Manassas VA, USA) and routinely authenticated using method described in the original paper and/or the short tandem repeat (STR) DNA profiling technology by the Genomic Core facility of UT Southwestern. Cells were cultured in RPMI1640 medium supplemented with FBS or charcoal stripped FBS (CFBS) (Highclone, Logan UT, USA) as indicated. Stable cell lines LNCaP-ctl and LNCaP-4B were established using lentiviruses expressing vector and Flag-KDM4B, respectively, and subsequent selection with blasticidin. Plasmids and siRNA transfections were performed using lipofectamine 3000 and RNAimax, respectively.
Targeted deletion of KDM4B with CRISPR/CAS9
22Rv1 cells were electroporated with U6 target gRNA expression vector containing KDM4B-targeted gRNA (GCTGCAGCCATGGGGTCTCAGG) or lentiCRISP-GFP-v2 containing non-targeted control gRNA (CGCTTCCGCGGCCCGTTCA) along with plasmid expressing CAS9 (29). Cells were FACS sorted in single cell to 96-well plates. Clonal cells were genotyped. Deletion or KD of KDM4B was confirmed by qPR-PCR and western blot analysis. Multiple clonal controls were selected and showed no difference in growth rate.
Cell proliferation assays
Cell proliferation assays were performed using MTT cell proliferation assay kit (ATCC) or trypan blue staining. For drug inhibition assay, cells were seeded for one day before various concentrations of drug were added. Cells were cultured for additional 3 days before harvested for MTT/trypan blue assays.
RNA isolation, quantitative real-time polymerase chain reaction (qRT-PCR), and RNA-seq
Total RNA was isolated using TRIzol reagent (Invitrogen) according to manufacturer’s procedures. RNA (5 mg) was used to generate cDNA using Superscript III (Invitrogen). qRT-PCR was performed using SYBR Green (BioRad) with gene-specific primers. Data were normalized to an internal standard as indicated (ΔCT method). RNA-seq experiments were performed commercially by Novogene. qRT-PCR primers were listed in supplemental table 1.
Antibodies, immunoblotting, immunoprecipitation, and immunofluorescence
Following antibodies were used: pmTOR, mTOR, pS6, S6 kinase, KDM4B, Histone 3, cleaved PARP1, KDM6A, and KDM6B (Cell signaling), H3K9me3 and H3K27me3 (Abcam), GAPDH and SNAI2 (Santa Cruz), E-cadherin (BD company), SYP, PSA, and AR (cell Margue), and AR-V7 (Proteintech). Immunoblotting, immunoprecipitation, and immunofluorescence were performed according to the standard protocol.
IHC and scoring
Histological sections of prostate biopsy tissue samples from 106 patients with localized or metastatic hormone-sensitive prostate cancer (AJCC stage III and IV) underwent ADT (supplemental Table S2) were stained with anti-KDM4B antibody. These patients with informed consent were from the First Affiliated Hospital of Sun Yat-sen University, Jiangmen Hospital of Sun Yat-sen University and Affiliated Yantai Yuhuangding Hospital of Qingdao University Medical College from January 2000 to December 2010. Slides were examined and scored by two experienced pathologists independently who were blind to all clinical data. KDM4B expression was evaluated considering only the carcinoma cells and using a semi-quantitative scoring system. Briefly, the number of positive cells were counted and scaled: 0, no positive cells; 1, 1-25% positive cells; 2, 26-50% positive cells; 3, 51-75% positive cells; 4, 76-100% positive cells. 0-2 was regarded as low expression group and 3-4 was high expression group. We then analyzed the effect of KDM4B expression on patients’ overall survival time via Kaplan-Meier survival analysis and COX Proportional Hazard Model.
Xenograft model
PCa cells (3x106 cells/site) mixed with Matrigel (BD Biosciences) were injected subcutaneously into right and left leg of NOD/SCID mouse. Once tumor becomes palpable, tumor volume (mm3) was measured every 3 days with caliper and was calculated using the ellipsoid formula (π/6 x length x width x depth). For drug treatment, mice bearing palpable xenografts were randomized into different groups treated with vehicles, B3, enzalutamide, rapamycin, B3+enzalutamide, B3+rapamycin. Drugs were administered using minipump continuously for 7 days (for VCaP xenograft) or intraperitoneal injection with 3 times/weeks for 2 weeks at dose indicated in the respective figures (For 22Rv1 xenograft). Tumors were excised and weighted at time of sacrifice and used for target validation. All animal protocols were approved by the Institutional Animal Care and Use Committee in UT Southwestern Medical Center. Only male mice were used since prostate cancer is male-only disease.
Ex vivo culture of human prostate tumors
Fresh prostate tumor was obtained with informed consent from a 68 years-old man with Gleason 9 metastatic PCa undergoing radical prostatectomy at the first affiliated hospital of Sun-Yat-San university. The patient was previously diagnosed with Gleason 8 (5+3) PCa, gave up the surgery voluntarily, and chose bicalutamide 50mg once daily. After 20 months anti-androgen therapy, PCa progressed to Gleason 9 (5+4) and can be considered as CRPC. Tissues were cultured at 37oC with vehicle (DMSO) alone or B3 2.5 (mM) for two days as described (27), then formalin-fixed and paraffin-embedded for IHC.
Jumonji histone demethylase activity assays
Nuclear extracts were generated using cells treated with B3 or vehicle for 24 hours using EpiQuik Nuclear Extraction Kit (Epigentek, OP-0002-1) according to the manufacturer’s instructions. Nuclear extracts were used as the enzyme source to measure demethylase activity on exogenous H3K4me3, H3K9me3 or H3K27me3 substrates, using Epigenase JARID Demethylase Activity/Inhibition Assay Kit (Epigentek, P-3083) for H3K4me3 demethylation, Epigenase™ JMJD2 Demethylase Activity/Inhibition Assay Kit (Epigentek, P-3081) for H3K9me3 demethylation and Epigenase™ JMJD3/UTX Demethylase Activity/Inhibition Assay Kit (Epigentek, P-3085) for H3K27me3 demethylation. The reaction was carried out in 50 mL reactions with 1 mM a-ketoglutarate, 2 mM ascorbate, 100 mM (NH4)2Fe(SO4)2.6H2O (Sigma, 215406), 50 ng substrate (either H3K4me3, H3K9me3 or H3K27me3), 0.25x of EDTA free protease inhibitor (Roche, 05 892 791 001) and 15 mg nuclear extract at 37oC for 2 hours. A mix of nuclear extracts that were subjected to heat inactivation at 95oC for 10 minutes then cooled to 30oC was used as the negative control. Activity was determined by subtracting the values obtained from the heat inactive samples from the active nuclear extracts for reactions performed at the same time.
Statistical analysis
All data are shown as mean ± SD or SEM as stated. Student’s t test (2-tailed) was used to compare the difference between 2 groups that passed normality test. p < 0.05 was considered statistically significant. Graphpad Prism 9 was used to calculate IC50.