Do Digestive Bacteria Suffer from Oxidative Stress: A Study on Ruminal Bacteria

doi:10.21203/rs.3.rs-960221/v1

Download PDF

Research Article

Do Digestive Bacteria Suffer from Oxidative Stress: A Study on Ruminal Bacteria

https://doi.org/10.21203/rs.3.rs-960221/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Heating oils and oilseeds results in oxidized fatty acids with potential antimicrobial properties, that could affect digestive microbiota and therefore health. A long-term in vitro study was conducted to check the effects of one hydroperoxide, 13OOH cis-9,trans-11-C18:2 (13HPOD), and two aldehydes, hexanal and trans-2,trans-4-decadienal (T2T4D), on rumen bacteria and superoxide dismutase (SOD) activity. Rumen fluid was incubated with one of the three oxidation products for 54 h or 102 h. Controls without oxidation products were also incubated. Increasing incubation duration changed the bacterial community and caused acidification and probably oxidative stress, resulting in increased SOD activity. The bacterial community was highly affected by T2T4D, in particular the Bacteroidetes/Firmicutes ratio and the relative abundance of the Bacteroidales S24-7 group family, leading to an alteration of fermentation responsible for a higher final pH than those in control cultures and a diminution of SOD activity. Other oxidative products did not affect SOD activity, and hexanal did not modify the bacterial community compared to that of the control. The modification of the bacterial community by T2T4D represents a potential risk for the health of its host. Oxidative stress needs to be investigated in digestive ecosystems.

General Microbiology

rumen

microbiota

hydroperoxide

aldehyde

lipid oxidation

When heated, unsaturated fats undergo peroxidation, leading to the formation of lipid oxidation products (LOPs) in three steps [1]. The first step forms hydroperoxides (HPODs), and the last step mainly forms aldehydes. In humans, HPODs and mainly their stable reduced forms, hydroxyacids, are increased during oxidative stress generated by diseases such as diabetes or atherosclerosis [2]. LOPs of linoleic acid (LA),i.e., 9- and 13-hydroxyoctadecadienoic acids in atherosclerotic lesions and in LDL in patients, are the most abundant. In animals, oxidative stress is also known to alter health [3]. For example, in dairy cows, lipid peroxidation can reduce their capacity of reproduction (inactivation of steroidogenic enzymes, retained placenta or milk fever) and impair immunological responses (see review of Miller et al. [4]). These studies target inside the body, but there are very few studies exploring the effects of LOP in the digestive tract. To our knowledge, there has been no human study, and only 2 in vitro animal studies of rumen content have investigated the effects of the addition of pure LPOs, including HPODs, on the digestive microbiota and its activity [5, 6]. Other studies using heated fat are available in animals and show a modification of the digestive microbiota and its activity with heated fat in vitro with rumen content [7] and in the gut of broilers [8]. On the other hand, antioxidants are also potent modulators of the ruminal microbiota [9]. All these studies suggest a possible action of LOPs on the digestive microbiota.

Indeed, LOPs could act on bacteria: peroxides affect anaerobes [10], and aldehydes have antimicrobial effects that increase with chain length [11] and degree of unsaturation [12]. On the other hand, several bacteria respond to oxidative stress in the gut through the synthesis of superoxide dismutase (SOD), including ruminal bacteria [13, 14], which could lead the host to be less exposed to food LOPs.

A previous in vitro study using short-term (6 h and 24 h) batch cultures did not show any important effects of LOP on the microbiota, despite the great effects of HPODs and long-chain unsaturated aldehydes on lipid metabolism [6]. Indeed, changes inthe rumen microbiota could be too slow to be exhibited with such short incubation times. Moreover, inactivated bacterial DNA is detected as efficiently as DNA from active bacteria, so a bacteriostatic effect could not be explored.

The objectives of this study were to explore the effect of LOPs from LA on digestive bacteria using rumen content culture, with the view that many strains are shared between the human intestinal and ruminal microbiomes[15]. We aimed 1) to compare the long-term effects of the major LOPs from LA on the ruminal bacterial community and 2) to check the ruminal bacterial response to oxidative stress by assaying SOD activity.

This study aimed to evidence in vitro an effects of HPOD resulting from LA oxidation, 13OOH cis-9,trans-11-C18:2 (13HPOD), and the two aldehydes produced from LA oxidation, hexanal (HEX) and trans-2,trans-4-decadienal (T2T4D) on digestive microbiota. Ruminal content was used for this test and incubated for 54 or 102 hours.

The pH of the ruminal cultures incubated for 54 h was higher than the pH of 102 h cultures: 5.9 vs. 5.7, on average, respectively,from an initial value of 7.0 before incubation (Supplemental table S1). The addition of T2T4D to the cultures led to a higher final pH than the other treatments (Fig. 1). Regardless of the duration of incubation, the addition of LA LOPsdid not modify rumen bacterial abundances and diversity (Supplemental table S1). Diversity indexes were slightly affected by incubation duration, and the abundance of total bacteria was not modified by culture duration.

The bacterial antioxidant activity was estimated through SOD activity. Cultures exhibited a higher SOD activity after 102 h of incubation than after 54 h: 9.2 vs. 6.9 UI/ml, respectively. For both durations, T2T4D resulted in a lower SOD activity than the other treatments, which did not differ in SOD activity (Fig. 1).

Ruminal bacteria were mainly represented by 2 phyla (Fig.2),Bacteroidetes and Firmicutes, which represented 50% and 40% of total sequences on average, respectively. Actinobacteria, Spirochaetes and Proteobacteria accounted for 5%, 4% and 3% of the total sequences, respectively. Some minor (< 1% of total sequences) phyla were identified: Fibrobacteres, Synergistetes, Lentisphaerae and Saccharibacteria.

Figure 2 presents the evolution of ruminal bacterial phyla during 54 h and 102 h cultures with or without LA LPOs. Statistical effects are shown in supplemental table-S2. Globally, ruminal content culture modified the bacterial community by decreasing Bacteroidetes and increasing Firmicutes, Actinobacteria, Spirochaetes and Proteobacteria, but with various responses according to LA LOP added, and there wasa significant interaction between incubation time and the nature of the LA LOP (Supplemental table S2). The effect of incubation time on theBacteroidetes/Firmicutes ratio was greatly strengthened by the addition of T2T4D and,to a lesser extent, by 13-HPOD. The addition of T2T4D also enhanced the increase inActinobacteriawith increasing incubation time but not the changes inSpirochaetes and Proteobacteria and even counteracted them (Fig. 2);the effects were small for Proteobacteria.

Hence, those interactions led to the highest relative abundance being in 102 h cultures with T2T4D compared to others for Actinobacteria, particularly for the Bifidobacterium genus (Supplemental table S2). In the Bacteroidetes phylum, theBacteroidales S24-7 group unknown genus (Fig. 3) and Prevotella 1 genus were drastically decreased in 102 h cultures in the presence of T2T4D, while the Prevotella 7 genus was highly increased in these cultures compared to other media. Interactions were much less important for Firmicutesthan for Bacteroidetes. Moreover, Firmicutes bacteria were slightly affected by the incubation time. Nevertheless, if the effects of LA LPOswere significant, the highest values were for cultures with T2T4D compared to other cultures, particularly for the Lachnospiraceae family. For Spirochaetes, the addition of T2T4D to the medium led to a high decrease in the relative abundance of the Treponema 2 genus, mainly after 102 h of incubation, while in other cultures,this abundance increased with incubation time.

Figure 4shows the sPLS-DA results obtained with treatments (control, HEX, 13HPOD or T2T4D) as discriminant factors. This figure shows 4 groups: 3 closed groups (control, HEX and HPOD) with an intersection, and the T2T4D group separated from the others. Except for theButyrivibrio 2 and Prevotella 7genera, the major contributors to the explanation of this component were very minor bacteria (i.e., relative abundances< 0.01).

We chose to use the SOD assay to explore possible antioxidant responses of bacteria to our LA LPOs. A potential link between bacteria and SOD activity in the rumen is presented in Figure 5 (sPLS). Among bacteria with a relative abundance > 0.01, the Treponema 2, Prevotella 1 and Atopobiumgenera were positively correlated, while theRikenellaceaeRC9 gut group and Bacteroidales S24-7 group unknown genus were negatively correlated with SOD activity.

Effect of long-term incubations on the bacterial community

Bacterial abundance and diversity were not affected by culture duration. The Shannon index was difficult to compare withits values in other studies, but the Simpson index, which measures the probability that two individuals randomly selected from a sample will belong to the same OTU, suggests a low diversity of our rumen content. This poor diversity of the rumen content of our donor cows was probably due to the 10 kg of concentrates in their diet [21] and may have hidden an effect of incubations.

The total bacterial abundances reported in this study (9.7 log copies of DNA/ml, 11 log copies of DNA/mg, or 2.4´10¹¹copies of DNA per g of DM of cultures, on overall average) is similar to those reported by Henderson et al [29]for cows and sheep and Singh et al. [30]for buffaloes but slightly higher than the values obtained by the enumeration of total bacteria in a study of Mosoni et al. [31] on sheep: 10¹⁰ cells per g of DM rumen content regardless of the diet (100% hay or hay plus concentrates (50/50)). This difference could be explained by the presence of more than one copy of the target gene in some bacteria [32].

During incubation, we observed a decrease inBacteroidetes, increasesinActinobacteria and Proteobacteria, a slight increase inFirmicutes and a marked increase inSpirochaetes relative abundances. This effect of incubation time should be compared to the medium acidification (pH decrease from 7.0 just before incubation to 5.8 just after the end of incubation, on overall average). The effect of low pH on the ruminal population has mainly been examined in studies on ruminal acidosis.Zened et al. [21] showed nearly the same effect on bacterial phyla in vivo with a high starch diet, except that Firmicuteswas not affected and Spirochaeteswas not reported. Nevertheless, other studies on ruminal acidosishave demonstrated increasedFirmicutesat low ruminal pH [33]. Plaizier et al. [34] reported a slight increase in Spirochetes in the faeces but not in the rumen of cows receiving a subacute rumen acidosis-inducing diet. Therefore, the evolution of bacterial populations during our long-term incubations could be, at least in part, due to the acidification of the media, probably by accumulation of volatile fatty acids produced by bacterial fermentations.

Effect of lipid oxidation products on the bacterial community

Heating high-LA fats increases their HEX, T2T4D and 13HPOD contents [6, 18], whose effects were investigated separately in the present study through the addition of 13HPOD, HEX and T2T4D into cultures with a digestive microbiota. To our knowledge, this is the first study to report the effects of LA LPOs on the gut microbiota and SOD activity.

Bacterial abundancy and diversity were not affected by the tested LA LPOs, as reported in a previous study using short-term incubations [6]. Except for T2T4D, the LPOs had no effect on the final pH, which was identical to that of the control.Bacterial populations were highly affected by T2T4D, whilecompared to the control, 13HPOD had a slight and intermediate effect (between T2T4D and control) and HEX had no effect (Fig. 2). The addition of T2T4D highly decreased Bacteroidetes except the Prevotella 7 genus and highly increased Firmicutes, leading to an inversion of the Bacteroidetes/Firmicutes ratio. These effects were mainly observed in 102 h cultures, acting in synergy with incubation duration (Supplemental table S2). Among Bacteroidetes, the Bacteroidales S24-7 group family was the most affected and nearly disappeared in 102 h T2T4D cultures (Fig. 3), when Firmicutes taxa all increased. The addition of T2T4D also highly increased Actinobacteria.

On figure 3, component 1 is the component discriminating the T2T4D treatment from the control and other treatments. On this component the major contributor was a minor taxon, strongly linked with T2T4D addition: Pseudobutyrivibrio. Among the other taxa favoured by T2T4D, 2 major taxa emerged (the Butyrivibrio 2 and Prevotella 7genera).This resultis consistent with GLM analysisresults (Supplemental table S2)and suggested that these bacteria would resist T2T4D addition.Kubo et al. [11] reported an antimicrobial effect of long and unsaturated aldehydes on some bacteria but did not test their effect on bacteria belonging to the Bacteroidetes phylum, nor others identified par sPLS. They also showed that HEX had no effect on the growth of their selected bacteria in monocultures.

The addition of 13HPOD decreased the Bacteroidetes/Firmicutes ratio in 102 h cultures by decreasing Bacteroidetes and increasing Firmicutes, mainly by acting on minor taxa. Huws et al. [5] showed an effect of hydroperoxyoctadecatrienoic acid (HPOD obtained from oxidation of a-linolenic acid of grass) on the ruminal microbiota. They found that this HPOD has potential antimicrobial activity, particularly on Prevotellaceae, Lachnospiraceae and Ruminococcaceae, which was not the case in our study with an LA HPOD. On the other hand, Fanta et al. [35] reported a bacteriostatic effect of peroxides. In fact, in our study, 13HPOD results were intermediate between those of control and T2T4D cultures, which could be due to a reduction of HPOD to aldehydes, including T2T4D.

Greatest effect of lipid oxidation products and potential consequences for health

The greatest effect of 13HPOD and mainly T2T4D was the decrease in theBacteroidales S24-7group family and the great diminution of the Bacteroidetes/Firmicutes ratio. The Bacteroidales S24-7group could act in favour of diabetes protection in mice [36]and of diarrhoea protection during weaning in pigs[37]. From a more global point of view, Krych et al. [36] suggested that a decrease inthe Bacteroidetes/Firmicutes ratio could promote diabetes, and Castaner et al. [38] reported a link between the diminution of this ratio and obesity in humans. In ruminants, a decrease in the Bacteroidetes/Firmicutes ratio is generally associated with subacute ruminal acidosis, which is associated with systemic inflammation when acow’s diet is rich in grains. Some metabolites produced by ruminal bacteria, such as lipopolysaccharides, could be responsive to the inflammatory response, at least in part [33]. However, the relationship between the ruminal microbiome and health is still unclear in ruminants. Nevertheless, all these studies suggest a potential negative effect on the health of animals and humans eating T2T4D through a great modification of their gut microbiota.

Response of bacteria to oxidative stress

To investigate the gut bacterial response to LA LPO addition, we chose to measure SOD activity. Prolonging incubation provoked a marked increase in SOD activity, even in controls, which exhibited activities of 7.27 and 9.61 UI/ml for 54 h and 102 h of incubation, respectively. Gazi et al. [27] observed an increase in SOD activity in their ruminal batch cultures until 18 h. Thereafter, SOD activity decreased until 24 h (the end of their incubations), probably because of decreased bacterial activity due to decreased available fermentative substrate. In our experiment, the increased SOD activity over time was consistent with that ofa previous study and could be the result of the oxidative stress increasing with increasing batch culture duration.

None of our tested oxidation products stimulated SOD activity, which even decreased with T2T4D, probably as a result of a global decrease in bacterial community activity, as shown by the higher final pH in these media than in others. Nevertheless, there are many antioxidant systems in the rumen [39], so the lack of an effect on the SOD activity did not mean that the antioxidant response was not increased when oxidation products were added to the media.

Links between OTUs and SOD activity were studied. Fulghum and Worthington [13] studied the SOD capacity of some ruminal bacteria. Among them Prevotellaruminicola subsp. brevis and Succinivibriodextrinosolvens had great SOD activity, and Ruminococcusalbus had slight SOD activity, but the researchers did not study the Treponema or Atopobiumgenera. If we suppose that the real oxidative stress in our study was mainly caused by prolonged incubation, the TreponemaandAtopobiumgenera were greatly increased over time and were probably able to resist better than some other bacteria, particularly theBacteroidales S24-7group family. These bacteria could not produce SOD and were very sensitive to oxidative stress during incubation (-52%), in contrast to other major Bacteroidetes (nearly stable or increased over time). In addition, already affected by batch incubation,the Bacteroidales S24-7 group family could have been strongly impacted by the addition of T2T4D. Nevertheless, it is difficult to interpret a correlation that could just be coevolution and to separate the effect of eventual oxidative stress from an effect of acidification. Further studies are necessary to understand how the digestive microbiota as a whole and individual bacteria resistedthe oxidative stress generated in their ecosystem.

Long-term batch cultures demonstrated the effects of some oxidation-producing bacterial communities despite some bacteria generating oxidative stress. The bacterial community was highly affected by T2T4D, leading to an alteration of fermentation that produced a higher final pH in its culturesthan in others and an alteration of SOD activity. Modification of a bacterial community potentially represent a risk for the health of its host, but in vivo studies should be performed to reach conclusions. On the other hand, as digestive bacteria could suffer from oxidative stress, such phenomena must be studied themselves.

Long-term batch cultures

One HPOD resulting from LA oxidation, 13OOH cis-9,trans-11-C18:2 (13HPOD), and the two aldehydes produced from LA oxidation, hexanal (HEX) (purity ≥ 97%, Sigma Co., St Louis, MO, USA) and trans-2,trans-4-decadienal (T2T4D) (purity ≥ 85%, Sigma Co., St Louis, MO, USA), were selected for this experiment. 13HPOD was synthesized in the laboratory from pure LA using the methods of Fauconnier et al. [16] and Lopez-Nicolas et al. [17], as described in Kaleem et al. [6]. Before the experiment, the 13-HPOD in this preparation was quantified as described later to a purity of 78%.

These LOPs were chosen to be one HPOD, a saturated short chain aldehyde and an unsaturated long chain aldehyde from LA oxidation: 13HPOD is the most abundant HPOD from LA oxidation in heated and/or stored oil and high-LA seeds [18, 19] and an excellent marker of lipid peroxidation [20]; HEX and T2T4D are the most abundant saturated short-chain and unsaturated long-chain aldehydes generated during LA oxidation in oil and seeds [18, 19].

Incubations were conducted in Erlenmeyer flasks with a fermentative substrate (1 g of 2 mm-ground meadow hay, 0.2 g of 1 mm-ground soybean meal and 0.25 g of 1 mm-ground corn grain) and no oxidation product (controls), 30 mg of 13-HPOD, 10 mg of HEX or 10 mg of T2T4D (extrapolated from Kaleem et al. [6]). Ruminal fluid was collected from a lactating cow before the morning meal. The cow was fed a corn silage-based diet (36 kg of corn silage, 4 kg of soybean meal, 2 kg of hay, 1.5 kg of ground corn, 1.5 kg of ground wheat, 3 kg of concentrates, 0.2 kg of a mineral and vitamin supplement, and 30 g of salt). The rumen fluid was strained through a metal sieve (1.6 mm mesh) and transported to the laboratory under anaerobic and dark conditions, maintaining its temperature at 39°C. In the laboratory, 40 ml of rumen and 40 ml of bicarbonate buffer with minerals for bacterial growth (pH = 7; Na₂HPO₄.12H₂O 19.5 g/l and NaHCO₃9.24 g/l: NaCl 0.705 g/l; KCl 0.675 g/l; CaCl₂.2H₂O 0.108 g/l and MgSO₄.7H₂O 0.180 g/l, gazed with CO₂ and heated at 39°C) were added to the flasks, and the pH was measured. The flasks were then placed in a water bath rotary shaker (Aquatron; Infors AG, 4103 Bottmingen, Germany) at 39°C, filled with CO₂, and closed with a rubber lid cap with an inserted plastic tube leading into the water to vent fermentation gas without oxygen entrance. Flasks were stirred at 130 rpm and not exposed to light during incubation. Every 24 h of incubation, the same quantities of LOP and fermentative substrate as at day 1 were added to each flask along with 20 mL of bicarbonate buffer. Incubations were stopped 54 or 102 h after the beginning of the incubations. To study LA biohydrogenation, 60 mg of pure LA was added 5 h before stopping incubation (data not shown). Controls were prepared and incubated without oxidation products or LA. Three series of incubations were necessary to obtain 6 replicates per treatment and incubation duration.

Once the incubation was completed, the flasks were removed from the water bath and immediately placed in crushed ice. The pH was measured, and 1 mL of each culture was placed in an Eppendorf tube for bacterial community analysis and stored at -80°C until analysis. The rest of the flask was immediately stored at -18°C. The samples were freeze-dried (VirTisFreezemobile 25; Virtis, Gardiner, NY) and weighed. Flask contents were ground and homogenized in a ball mill (Dangoumau, Prolabo, Nogent-sur-Marne, France) and kept at -18°C for later analysis of SOD activity. Bacterial abundance was assessed by total qPCR.

Microbiological analyses

Total DNA from 1 ml of freeze-dried ruminal samples was extracted and purified using the QIAamps DNA Stool Mini kit (Qiagen Ltd, West Sussex, UK) according to the manufacturer’s documentation after a bead-beating step in a FastPrep Instrument (MP Biomedicals, Illkirch, France).The V3-V4 regions of 16S rRNA genes of samples were amplified from purified genomic DNA with the primers F343 and reverse R784, and PCR was carried out as described in Zened et al. [21]. As Illumina MiSeq technology enables paired-end 250-bp reads, we obtained overlapped reads that generated extremely high-quality, full-length reads of the entire V3 and V4 regions in a single run. Single multiplexing was performed using a 6 bp index, which was added to R784 during a second PCR with 12 cycles using forward (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC) and reverse primers (CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGT). The resulting PCR products were purified and loaded onto an Illumina MiSeq cartridge (Illumina, San Diego, CA, USA) at the Genomic and Transcriptomic Platform (INRAE, Toulouse, France) according to the manufacturers’ instructions. The raw reads were treated with the FROGS pipeline [22] by following the FROGS’ operational procedure: (i) read demultiplexing, i.e., each pair-end read was assigned to its sample with the help of the previously integrated index. (ii) read preprocessing, i.e., removing sequences that did not match the proximal PCR primer sequences, removing sequences not between minimum and maximum sequencing length (less than 397 nucleotides and higher than 432) and removing sequences with at least one ambiguous base, (iii) chimaera removal, (iv) sequence clustering in OTUs (operational taxonomic units) with denoising=yes and d=3, (v) OTU filtering, i.e., OTUs with abundances above 0.005% of total sequences and present in at least 6 samples were retained, and (vi) OTU affiliation using the SILVA database (version 128) [23].

The total number of bacteria in the cultures was estimated by quantitative polymerase chain reaction (qPCR), as described in Combes et al. [24]. Assays were performed using the ABI Prism 7900HT sequence detection system (Applied Biosystems, Carlsbad, CA, USA) in optical grade 384-well plates in a final volume of 10 µl. The SYBR Green assay reaction mixture contained template DNA, a specific primer set at 100 nM (forward: ACTCCTACGGGAGGCAGCAG; reverse: ATTACCGCGGCTGCTGG) and 1X Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). A dissociation curve was added to SYBR Green assays to check the specificity of the amplification. Then, the results were compared with a standard curve to obtain the number of target copies in the sample. Standard DNA curves were generated by amplification of serial 10-fold dilutions of a reference plasmid containing the target 16S rRNA gene (accession no. EF445235 Prevotellabryantii).

Superoxide dismutase activity

The SOD activity was measured in ruminal cultures. Total SOD activity was evaluated by measuring the inhibition of pyrogallol activity, as described by Gladine et al. [25].

Statistical Analysis

The bacterial diversity was estimated by Shannon and Simpson indexes with the R package phyloseq[26]. The relative abundances of bacteria, bacterial diversity indexes and SOD activity were compared using the general linear model of SYSTAT (Version 9, SPSS Inc., 1998, Chicago, IL) and are reported as the mean values with the standard errors of the means. The model was:

Variable = mean + “series” effect + “treatment” effect + “incubation duration” effect + interaction “treatment ´ incubation duration” + residual error.

When a difference between treatments was significant, a pairwise comparison was performed using a Tukey test. Significance was declared at P≤0.05.

Analysis of the bacterial community was completed by a global approach using the package mixOmics[27] with R software (version 3.4.1). To remove noisy and uninformative clusters, an sPLS-DA was performed to select a small number of clusters (20 clusters per component) relevant to discriminate each treatment (i.e., control, 13HPOD, HEX and T2T4D), and a relevance network was built to search links between clusters selected by sPLS and SOD activity. Correlation coefficients were calculated using Pearson analysis. The network was visualized using Cytoscape software [28].

Acknowledgements

The authors thank M.L. Chemit, B. Gabinaud, and the staff at the experimental station (UMR GenPhySE) and A.S. Bage (UMR Herbivores). We are grateful to the genotoul bioinformatics platform Toulouse, Occitanie (BioinfoGenotoul, doi: 10.15454/1.5572369328961167E12), for providing help, computing and/or storage resources.

Author contributions

Annabelle Meynadier conceived the experiment, carried out the analysis of the data and their interpretation, and write the manuscript. Géraldine Pascal performed bioinformatics, Laurent Cauquil biostatistics andthe formatting of figures. Yves Farizon and Muhammad Kaleem conducted the trial. Sylvie Combes performed the microbiota quantification and Denys Durant the SOD activity. Francis Enjelbertparticipated to the analysis and interpretation of the results. All authors read, improved and approved the final manuscript.

Additional information

The authors have no competing financial interests

Data availability

Metabarcoding data was deposited in publicly accessible databases. Sequence data are accessible through SRA of NCBI (PRJNA733108).

Frankel EN. Lipid Oxidation - 2nd Edition. https://www.elsevier.com/books/lipid-oxidation/frankel/978-0-9531949-8-8. Accessed 12 Sep 2019.
Vangaveti V, Baune BT, Kennedy RL. Review: Hydroxyoctadecadienoic acids: novel regulators of macrophage differentiation and atherogenesis. Ther Adv Endocrinol Metab 2010; 1: 51–60.
Durand D, Damon M, Gobert M. Le stress oxydant chez les animaux de rente : principes généraux. Cah Nutr Diététique 2013; 48: 218–224.
Miller JK, Brzezinska-Slebodzinska E, Madsen FC. Oxidative stress, antioxidants, and animal function. J Dairy Sci 1993; 76: 2812–2823.
Huws SA, Scott MB, Tweed JKS, Lee MRF. Fatty acid oxidation products (‘green odour’) released from perennial ryegrass following biotic and abiotic stress, potentially have antimicrobial properties against the rumen microbiota resulting in decreased biohydrogenation. J Appl Microbiol 2013; 115: 1081–1090.
Kaleem A, Enjalbert F, Farizon Y, Troegeler-Meynadier A. Effect of chemical form, heating, and oxidation products of linoleic acid on rumen bacterial population and activities of biohydrogenating enzymes. J Dairy Sci 2013; 96: 7167–7180.
Privé F, Combes S, Cauquil L, Farizon Y, Enjalbert F, Troegeler-Meynadier A. Temperature and duration of heating of sunflower oil affect ruminal biohydrogenation of linoleic acid in vitro. J Dairy Sci 2010; 93: 711–722.
Goodarzi Boroojeni F, Vahjen W, Mader A, Knorr F, Ruhnke I, Röhe I, et al. The effects of different thermal treatments and organic acid levels in feed on microbial composition and activity in gastrointestinal tract of broilers. Poult Sci 2014; 93: 1440–1452.
Yoshimura EH, Santos NW, Machado E, Agustinho BC, Pereira LM, de Aguiar SC, et al. Effects of dairy cow diets supplied with flaxseed oil and propolis extract, with or without vitamin E, on the ruminal microbiota, biohydrogenation, and digestion. Anim Feed Sci Technol 2018; 241: 163–172.
Brioukhanov AL, Netrusov AI. Catalase and superoxide dismutase: distribution, properties, and physiological role in cells of strict anaerobes. Biochem Biokhimiia 2004; 69: 949–962.
Kubo A, Lunde CS, Kubo I. Antimicrobial Activity of the Olive Oil Flavor Compounds. J Agric Food Chem 1995; 43: 1629–1633.
Deng Wenlian, Hamilton-Kemp TR, Nielsen MT, Andersen RA, Collins GB, Hildebrand DF. Effects of six-carbon aldehydes and alcohols on bacterial proliferation. J Agric Food Chem 1993; 41: 506–510.
Fulghum RS, Worthington JM. Superoxide dismutase in ruminal bacteria. Appl Environ Microbiol 1984; 48: 675–677.
Lenártová V, Holovská K, Javorský P. The influence of mercury on the antioxidant enzyme activity of rumen bacteria Streptococcus bovis and Selenomonas ruminantium. FEMS Microbiol Ecol 1998; 27: 319–325.
Seshadri R, Leahy SC, Attwood GT, Teh KH, Lambie SC, Cookson AL, et al. Cultivation and sequencing of rumen microbiome members from the Hungate1000 Collection. Nat Biotechnol 2018; 36: 359–367.
Fauconnier M-L, Perez AG, Sanz C, Marlier M. Purification and Characterization of Tomato Leaf (Lycopersicon esculentum Mill.) Hydroperoxide Lyase. J Agric Food Chem 1997; 45: 4232–4236.
López-Nicolás JM, Pérez-Gilabert M, Garcı́a-Carmona F. Rapid reversed-phase high-performance liquid chromatographic determination of the regiospecificity of lipoxygenase products on linoleic acid. J Chromatogr A 1999; 859: 107–111.
Kaleem M, Farizon Y, Enjalbert F, Troegeler‐Meynadier A. Lipid oxidation products of heated soybeans as a possible cause of protection from ruminal biohydrogenation. Eur J Lipid Sci Technol 2013; 115: 161–169.
Kaleem M, Enjalbert F, Farizon Y, Meynadier A. Feeding heat-oxidized oil to dairy cows affects milk fat nutritional quality. animal 2018; 12: 183–188.
Spiteller P, Spiteller G. 9-Hydroxy-10,12-octadecadienoic acid (9-HODE) and 13-hydroxy-9,11-octadecadienoic acid (13-HODE): excellent markers for lipid peroxidation. Chem Phys Lipids 1997; 89: 131–139.
Zened A, Combes S, Cauquil L, Mariette J, Klopp C, Bouchez O, et al. Microbial ecology of the rumen evaluated by 454 GS FLX pyrosequencing is affected by starch and oil supplementation of diets. FEMS Microbiol Ecol 2013; 83: 504–514.
Escudié F, Auer L, Bernard M, Mariadassou M, Cauquil L, Vidal K, et al. FROGS: Find, Rapidly, OTUs with Galaxy Solution. Bioinformatics 2018; 34: 1287–1294.
Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 2013; 41: D590–D596.
Combes S, Michelland RJ, Monteils V, Cauquil L, Soulié V, Tran NU, et al. Postnatal development of the rabbit caecal microbiota composition and activity. FEMS Microbiol Ecol 2011; 77: 680–689.
Gladine C, Morand C, Rock E, Gruffat D, Bauchart D, Durand D. The antioxidative effect of plant extracts rich in polyphenols differs between liver and muscle tissues in rats fed n-3 PUFA rich diets. Anim Feed Sci Technol 2007; 139: 257–272.
McMurdie PJ, Holmes S. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. PLOS ONE 2013; 8: e61217.
Rohart F, Gautier B, Singh A, Lê Cao K-A. mixOmics: An R package for ’omics feature selection and multiple data integration. PLoS Comput Biol 2017; 13: e1005752.
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 2003; 13: 2498–2504.
Henderson G, Cox F, Kittelmann S, Miri VH, Zethof M, Noel SJ, et al. Effect of DNA Extraction Methods and Sampling Techniques on the Apparent Structure of Cow and Sheep Rumen Microbial Communities. PLoS ONE 2013; 8: e74787.
Singh KM, Pandya PR, Tripathi AK, Patel GR, Parnerkar S, Kothari RK, et al. Study of rumen metagenome community using qPCR under different diets. Meta Gene 2014; 2: 191–199.
Mosoni P, Chaucheyras-Durand F, Béra-Maillet C, Forano E. Quantification by real-time PCR of cellulolytic bacteria in the rumen of sheep after supplementation of a forage diet with readily fermentable carbohydrates: effect of a yeast additive. J Appl Microbiol 2007; 103: 2676–2685.
Stoddard SF, Smith BJ, Hein R, Roller BRK, Schmidt TM. rrnDB: improved tools for interpreting rRNA gene abundance in bacteria and archaea and a new foundation for future development. Nucleic Acids Res 2015; 43: D593–D598.
Khafipour E, Li S, Plaizier JC, Krause DO. Rumen Microbiome Composition Determined Using Two Nutritional Models of Subacute Ruminal Acidosis. Appl Environ Microbiol 2009; 75: 7115–7124.
Plaizier JC, Li S, Danscher AM, Derakshani H, Andersen PH, Khafipour E. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. Microb Ecol 2017; 74: 485–495.
Fanta D, Bardach H, Poitscheck Ch. Investigations on the bacteriostatic effect of benzoyl peroxide. Arch Dermatol Res 1979; 264: 369–371.
Krych Ł, Nielsen DS, Hansen AK, Hansen CHF. Gut microbial markers are associated with diabetes onset, regulatory imbalance, and IFN-γ level in NOD Mice. Gut Microbes 2015; 6: 101–109.
Sun J, Du L, Li X, Zhong H, Ding Y, Liu Z, et al. Identification of the core bacteria in rectums of diarrheic and non-diarrheic piglets. Sci Rep 2019; 9: 1–10.
Castaner O, Goday A, Park Y-M, Lee S-H, Magkos F, Shiow S-ATE, et al. The Gut Microbiome Profile in Obesity: A Systematic Review. Int J Endocrinol 2018; 2018: 1–9.
Gazi MR, Yokota M, Tanaka Y, Kanda S, Itabashi H. Effects of protozoa on the antioxidant activity in the ruminal fluid and blood plasma of cattle. Anim Sci J 2007; 78: 34–40.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Do Digestive Bacteria Suffer from Oxidative Stress: A Study on Ruminal Bacteria

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1