TDSC isolation and cell culture
Achilles tendons (AT) were harvested from one of the hindlimbs of Sprague–Dawley (SD) rats, anesthetized with 0.5% pentobarbital sodium (0.3 mL/100 g, Sigma-Aldrich) by intraperitoneal administration. Pieces of the ATs 0.5 × 1.0 cm2 were isolated, cut into 0.25 cm3 pieces and digested with type I collagenase (2 mg/mL; Sigma-Aldrich, St Louis, MO, USA) in DMEM supplemented with 2% fetal bovine serum for 16 h at 37°C and collected using a 70-mm cell strainer to produce a single cell suspension. The cells were washed in PBS by centrifugation at 800 × g for 5 min then reseeded at 1 × 104 cells/cm2 in monolayer cultures in complete high glucose DMEM (HG-DMEM) supplemented with 20% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin. After 24 h of initial culture, the rapidly-adherent, fibroblast-like cells were excluded by transferring the nonadherent cells to fresh culture flasks. At day 7, TDSCs were trypsinized and mixed together as passage 0, after which they were passaged four or five times before use for experiments.
Flow cytometry assay
In order to confirm the presence of surface antigens characteristic of TDSCs, TDSCs at passage 4 were harvested by digestion with 0.25% trypsin/ ethylenediaminetetraacetic acid (EDTA) as described above. Approximately 1 × 106 cells separated through centrifugation were incubated with 1 mg fluorescein isothiocyanate (FITC) or phycoerythrin (PE) fluorescent dyes conjugated with anti-rat monoclonal antibodies (CD44, CD45, and CD90), then fixed in 4% paraformaldehyde at room temperature for 20 minutes. After washing with 200 μL PBS (pH = 7.4), cells were removed from the fixing solution and resuspended in PBS for flow cytometry. Analysis of the phenotypic results was performed with an FC 500 Flow Cytometry Analyzer (Beckman Coulter, Brea, CA, USA).
Laser intervention method
A 532 nm Nd:YAG laser (Oculight; Iridex, Mountain View, CA, USA) with a diameter of 5 mm was used. During the irradiation, the distance between the laser emitter and the cell layer was kept at 6 cm for all cell groups. Sterile foil was used to create an enclosed space to prevent interference caused by light dispersion and refraction. After irradiation, the cells were returned to the incubator for further culture, and the stem cell culture medium was replaced every 1–2 days.
Cell Titer-Glo (CTG) assay
In order to determine the effect of 532 nm laser irradiation with different energy densities on cell viability, so as to choose a reasonable energy density for subsequent experiments, cells were seeded into 96-well plates at a density of 1 × 104 cells/well. The cells were then assigned to one of seven energy density laser groups (0 J/cm2, 1.5 J/cm2, 3 J/cm2, 6 J/cm2, 9 J/cm2, 15 J/cm2 and 24 J/cm2). The irradiation times for these seven groups were: 0 s, 30 s, 60 s, 2 min, 3 min, 5 min, and 8 min, respectively. The CTG assay was performed at 24 and 48 h after a single exposure.
Crystal Violet assay
To determine the effects of 532 nm laser irradiation on cell activity and proliferation, cells were seeded into 96-well plates at a density of 1 × 104 and incubated at 37°C in a constant temperature incubator. After 6, 12, or 24 h, the culture medium was removed, and cells were fixed with 4% paraformaldehyde (PFA) solution for 15 min at room temperature (RT). Then, cells were washed with PBS, and each well was stained with 100 µL of 0.2% Crystal Violet solution in PBS for 15 min at RT. Deionized water was used to wash the dye solution from the plates, and the dye was then solubilized in 100 µL of 1% sodium dodecyl sulfate (SDS) solution in PBS. Optical density (OD) was measured at an emission wavelength of 570 nm using a microplate reader to compare the cell proliferation of the two groups.
Quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR)
RT-PCR was performed to analyze the differentiation-related gene expression after 24 and 48 h of 532 nm laser single irradiation. Total RNA was extracted using an RNA purification kit (Corning, Corning, NY, USA) according to the manufacturer’s instructions. Reverse transcription (RT) was performed using a Prime Script RT Reagent Kit (Takara Bio Inc., Shiga, Japan) to reverse transcribe RNA into cDNA. Real-time PCR was quantified using SYBR Premix Ex Taq (Takara Bio Inc.) in a Light Cycler® 96 System (Roche, Basel, Switzerland). The specific primers for differentiation-related genes (Invitrogen, Carlsbad, CA, USA) used in this study are listed in Table 1. GAPDH was used as an internal control. The results are presented as the relative expression ratios of the target sample to the control group for each sample, calculated using the 2-ΔΔCT method.
Western blotting
Total protein was collected from cultured cells using Lysis Buffer (RIPA, Beyotime, Shanghai, China) supplemented with 1% protease inhibitor (Roche Applied Science), and a total of 40 μg protein were loaded for electrophoresis. The proteins were separated by SDS polyacrylamide gel electrophoresis (SDS-PAGE) using a 10% gel, and transferred to a nitrocellulose membrane (Merck Millipore, Darmstadt, Germany). Membranes were blocked for 1 h with 5% nonfat milk at RT, and blots were probed with the following antibodies: anti-Nr4a1 (1:1,000, ab13851, Abcam, Cambridge, UK), anti-Scx (1:1,000, ab185940, Abcam), and anti-tenomodulin (1:1,000, ab203676, Abcam) at 4°C overnight. After washing in Tris-buffered saline containing Tween, the membrane was incubated with anti-rabbit IgG (1:1,000, ab205718, Abcam) for 1h at RT.
Gene chip microarray assay and analysis
After 48h of 532 nm single laser irradiation, cells of 532 nm laser group and control unirradiated cells were dissolved in Trizol (Life Technologies, USA) for total RNA isolation. RNA concentration was quantified using the EXON Gene Chip instrument (Affymetrix, Thermo Fisher Scientific, Waltham, MA, USA), and RNA integrity was assessed using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). For gene expression analysis, the Gene Chip Command Console software version 4.0 (Affymetrix) was used to extract raw data according to the manufacturer’s instructions. Basic analysis was performed using the Gene software version 13.1 (Agilent Technologies). RNA normalization was performed using the Expression Console software version 1.3.1 (Affymetrix). Ultimately, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and gene ontology (GO) analyses were applied to clarify the molecular functions of up-regulated genes and relevant pathways.
Tendon injury model
Thirty-six SD rats (male, 6-weeks-old) were obtained from the Laboratory Animal Services Centre. All the animals were housed in an environment with a temperature of 25 ± 1ºC, a relative humidity of 65 ± 5%, and a light/dark cycle of 12/12 hr. Animals were given water and sterilized food ad libitum. All animal studies (including the rat euthanasia procedure) were carried out in compliance with the regulations and guidelines of Shanghai Jiao Tong University institutional animal care and conducted according to the AAALAC and the IACUC guidelines.
Thirty-six rats were divided into two groups: a control group and a 532 nm laser group. For the tendon injury model, we adopted a rat model of Achilles-tendon injury following a previously-reported method [19]. The Achilles tendon was separated from the plantaris and soleus tendons and injury were surgically induced by semi-cutting, followed by primary suture repair. For rats in the laser group, the tendon was irradiated with a 532 nm laser and then sutured, while for those in the control group the tendons were directly sutured. Tendon tissue samples were collected 7 days after modeling.
Hematoxylin and eosin (H&E) staining
Normal and degenerative tendons were fixed with 4% paraformaldehyde, dehydrated with 30% sucrose, embedded in OCT (Sakura Finetek, Torrence, CA, USA), and frozen at -80°C before sectioning. Cryosections were cut at 5 μm thickness and stained with H&E (Sakura Finetek) to observe cell morphology and cell number. The samples were imaged using an upright microscope (Olympus, Tokyo, Japan).
Immunohistochemistry
The specimens of the tendon injury model were collected and divided into two groups for histological tests. The tissues were fixed in 4% paraformaldehyde solution, dehydrated with a series of graded ethanol, and then embedded in paraffin. Sections were stained as 5 mm-thick sections with Anti-Nr4a1 (1:1,000, ab13851, Abcam). After nonspecific reactive sites were blocked with 5% bovine serum albumin, slides were incubated overnight at 4°C with anti-rat targeted antibodies at 1:200 to 1:500 dilutions and then conjugated with goat anti-rabbit IgG (1:1500; Santa Cruz Biotechnology, Santa Cruz, CA, USA) secondary antibody in the dark at RT for 1 h. Finally, the sections were stained with 3,3′-diaminobenzidine and then counterstained with hematoxylin.
Cell transfection
The Nr4a1 coding sequence was cloned into the pCDNA3.1 (+) vector. The primers were as follows:
F: ATGCGATTCTGCAGCTCTTCC,
R: GGGTGGTATTGTCGTAGTAGAAGG.
TDSCs (5 × 103 cells/well) were plated into 6-well plates and transfected with either blank pCDNA3.1 (+) vector or pCDNA3.1(+)-Nr4a1. The transfection was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. After 6–8 h, TDSCs were washed and cultured for 24 h in complete medium.
Statistical analysis
All individual experiments were performed at least three times, with three replicates. Data are expressed as means ± standard deviation (SD). All statistical analyses were carried out using SPSS 13.0 (IBM, Armonk, NY, USA). Differences among more than two experimental groups were evaluated by one-way ANOVA. P ≤ 0.05 was considered statistically significant. Image J and GraphPad Prism software were used for plotting calculations.