Bioinformation data mining and analysis
The MTHFD2 mRNA status in Bladder Urothelial Carcinoma (BLCA) was analyzed via the Gene Expression Profiling Interactive Analysis (GEPIA) online database (http://gepia.cancer-pku.cn/) according to the creator of this website. |Log2FC| Cutoff and p-value Cutoff were set as 1 and 0.01, respectively. For the prognostic analysis of MTHFD2 in bladder cancer, the patients with BLCA was median dichotomized into high MTHFD2 group and low MTHFD2 group (cutoff=50%).
Cell culture, plasmids and transfection
Bladder cancer cell line EJ and the HEK239T cell line were purchased from the Cell Bank Wuhan University (China), and maintained in DMEM medium supplemented with 5% FBS and penicillin-streptomycin 100 U/mL in a standard cell culture incubator (37°C, 5% CO2). The AKT and MYC luciferase reporter gene vectors and Flag-MYC were gifted by school of life sciences, Wuhan University, Wuhan, China. Cell transfection was achieved with the aid of Lipofectamine 2000.
Overexpression of MTHFD2 in EJ cells
For construction of MTHFD2-flag plasmids, RT-PCRs were carried out to clone and amplify the human MTHFD2 and MYC cDNA from EJ cells. The PCR-amplified products were cleaved with BamHI and SalI and recovered by DNA gel recovery kit. The recovered SalI-BamH I sequences were inserted into pHAGE puro with 6tag, named Flag-MTHFD2 vectors and were subsequently introduced into 1х105 HEK293T cells for 2 days. The obtained retrovirus particles was filtered and infected EJ cells, following additional two-day selection with puromycin at 1 µg/ml. The positive cells was further validated by western blot analysis. The normal EJ cells served as the control.
Targeted depletion of MTHFD2 in EJ cells
MTHFD2 targeted depletion were produced in EJ cells via CRISPR/Cas9 system. The guide RNAs (gRNAs) targeted exon 1 of MTHFD2 were designed via the CRISPR online software (http://crispr.dfci.harvard.edu/SSC/) and inserted into pSpCas9 (BB)-2A-Puro plasmid. The recombinant vectors were introduced into EJ cells for 48h and the cells was subjected to 1 μg/ml Puromycin screening for 2 days. The MTHFD2 deficient EJ cells (KO-1, KO-2) were utilized for further cell functional assays after validation by western blot. The normal EJ cells served as the control.
CCK8 assays
Cell proliferation rate was examined with CCK8 approach.5.0×103 cells /well EJ cells were plated in 96-well plates. After 1, 3, and 5 days, 10 μl CCK8 solution was supplemented and cells were subjected to another 2h incubation. The OD value was monitor at 450 nm with a microplate reader.
Colony formation assay
After trypsinization, the logarithmic growth phase EJ cells were made into single cell suspensions by mechanical dissociation. A total of 2 × 102 EJ cells were seeded on dishes and incubated for 3 weeks. After fixation with 4% paraformaldehyde, colonies of EJ cells were visualized using 0.5% crystal violet and the crystal violet-stained colonies were counted under a microscope.
Soft agar colony formation assay
A 1 x 103 EJ cell-agarose suspension was pipetted onto a solidified bottom layer made of 0.5% agar in a 6-well plate. After 2-week growth of EJ cells, visible cell colonies were counted, and images were captured at ×20 magnification.
Transwell cell migration assay
Migration media containing 5 x 105 EJ cells/100 μl were added to each Transwell insert onto the receiving 12-well plate with medium containing 20% fetal bovine. After incubation for 2.5 h, the cell debris on the upper side of the insert was removed. The cells that migrated across the membrane were fixed with methanol for 10min, visualized with 1% crystal violet and counted using an inverted microscope.
Luciferase reporter gene assay
Considering AKT activation in cell metabolism[19], we examined the change in transcriptional activity of AKT upon MTHFD2 stimulation using dual-luciferase reporter gene assays. 10 ng AKT Luc vectors and 5 ng prl-tk empty control plasmid were cotransfected into HEK293T cells with 0,50,100, and 200ng MTHFD2-flag plasmids. After cotransfection for 2 days, the transcriptional activity was measured and standardized by Renilla control luciferase activity.
Besides AKT transcriptional activity in MTHFD2 EJ cells, further luciferase reporter assays were performed to examine the transcriptional activity of MYC which is one of active downstream molecules of AKT signaling pathway in multiple types of cancers[20, 21]. In brief, 10 ng AKT Luc vectors or 10ng MYC Luc vectors were separately introduced into 1.5 × 105 cells/well wide-type (WT) or both MTHFD2-deficient EJ cells with 5 ng prl-tk empty control plasmid. AKT and MYC luciferase activities were assessed again using the Renilla Luciferase assay kit.
Quantitative RT-PCR
Total RNA was extracted with Trizol agent and subjected for DNase І treatment. Subsequently, Denatured RNA was reverse transcribed into CDNA with random primer and an oligo(dT) primer. mRNA expression level was determined by qPCR with 2x SYBR Green qPCR SuperMix. The primers as follows:
CDK4:Forward primer GGATGACTGGCCTCGAGATG, Reverse primer: CAAGAAAGTTGGGCACTCCG; CCND2: Forward primer CCAACACAGACGTGGATTGT, Reverse primer:CAACTGGCATCCTCACAGGT. GAPDH: Forward primer CATGGCACCGTCAAGGCTGA, Reverse primer: ACGTACTCAGCGCCAGCATC.
Western blot analysis
Lysis of the indicated cells was performed by using RIPA buffer with cocktail inhibitor, and the supernatants containing proteins were collected after centrifuging lysates. Next, the protein concentration was determined by Bradford Assay, and equal amounts of proteins (20μg) were separated by 10% SDS-PAGE. The separated proteins were transferred to PVDF membranes. The membranes were blocked to eliminate nonspecific binding, and the primary and secondary antibodies were successively applied to detect the signals on the membranes. The following primary antibodies were used: anti-flag,anti-MTHFD2,anti-CCND2,anti-CDK4,anti-GAPDA。
Rescue of AKT activity by Overexpression of MYC
To verify if AKT/MYC is essential for MTHFD2-induced bladder cancer genesis and development, we transfected the 1.5 × 105 MTHFD2-deficient EJ cells with Flag-MYC vectors. The CCND2 and CDK4 expression was visualized by westernblot in widetype (WT), KO EJ cells and MYC-reexpressing KO EJ cells.
Statistical Analysis
All data were analyzed by Prism 8 statistical software. A difference was considered significant if p was less than 0.05. All data from experiments are presented as the mean ± SEM. Comparisons of two variables were examined with unpaired two-tailed Student’s t test. Comparisons of multiple variables were examined by ANOVA with Tukey’s post hoc test.