Ethics statement
This study was ratified and supervised by the ethics committee of Hainan Medical University. We made significant efforts to minimize animals used and their suffering.
Establishment of renal I/R model
After adaptive feeding for 3 days, the rats had free access to food and water and randomized to sham group (n = 10, rats received surgical procedures without renal arterial clamping); I/R group (n = 10, rats underwent renal ischemia for 45 minutes followed by 24-hour reperfusion); negative control (NC) group (n = 10, intravenous injection of 20 µg empty vectors for 15 minutes before renal artery clamping); knockdown TUG1 (ko-TUG1) group (n = 10, injected with 20 µg TUG1 [14] for 15 minutes after removal of renal artery clamp), ko-TUG1 + 3-MA group (n = 10, injected with 20 µg TUG1 and 3-MA (30 mg/kg, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) [15] for 15 minutes after removal of renal artery clamp).
Rats were anesthetized by intraperitoneal injection of 3% sodium pentobarbital (50 mg/kg). Then the right kidney of each rat was removed and the left renal artery was exposed and clamped for 45 minutes. Subsequently, the clamp was removed and the kidney was observed for 4–5 minutes to assure reperfusion was established successfully. After 24 hours of reperfusion, the left kidney of each rat was removed and rats were euthanized. The serum of 10 rats in each group was applied for detecting serum index, the kidney tissues of 3 rats was used for tissue homogenate, and the kidney tissues of 6 rats was used for tissue section detection.
Microarray analysis
Total RNA of kidney tissues in rats from the sham and I/R groups was extracted by a TRIzol kit (Invitrogen Inc., Carlsbad, CA, USA). Double strand cDNA was synthesized by SuperScript Double-stranded cDNA synthesis kit (Invitrogen), and labeled and hybridized to an lncRNA expression microarray (12 × 135K, Arraystar Inc., Rockville, MD, USA). After hybridization and washing, processed slides were scanned by an Axon GenePix 4000B scanner (Molecular Devices Inc., Sunnyvale, CA, USA). Raw data were extracted as pair files using NimbleScan software (Version 2.5; Roche). The threshold for up- and downregulated genes was set as fold change > = 1.5 and p value < = 0.05. All the above works were completed by Shanghai Sensichip Hightech Co., Ltd. (Shanghai, China). Hierarchical cluster analysis was done by Shanghai Novel Bioinformatics Company (Shanghai, China).
Detection of renal function
Peripheral blood samples obtained from each group were centrifuged at 3000 r/min for 10 minutes. Then 500 µL serum was taken for determination of serum creatinine (SCr) and blood urea nitrogen (BUN) using an automatic biochemical analyzer (Roche Diagnostics, Indianapolis, Indiana, USA) with an AU2700 Analyzer (Olympus, Tokyo, Japan).
Detection of contents of renal malondialdehyde (MDA) and superoxide dismutase (SOD)
The MDA content in the rat kidneys was measured using an MDA kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) and the thiobarbituric acid method [16]. The renal SOD content in rats was detected using a SOD kit (Nanjing Jiancheng Bioengineering Institute) [17].
Histological examination
Kidney tissues were fixed in 10% buffered formalin, embedded in paraffin and cut at 4-µm. After deparaffinization and rehydration, sections were stained with hematoxylin and eosin (HE) for the quantitative evaluation of renal injury score. A histologic score of tissue damage was estimated by two external pathologists according to the following criteria: tubular dilatation, cast deposition, brush border loss and necrosis in 25 randomly chosen non-overlapping fields. Lesions were graded on a scale from 0 (normal) to 5 (extensive damaged).
TUNEL assay
TUNEL assay was performed with an In situ cell death detection kit (fluorescein, Roche). Paraffined sections were deparaffinized, sectioned at 4-µm, treated with 20 mg/mL proteinase K, and treated with 3% hydrogen peroxide. Subsequently, the sections were treated with a mixture of nucleotides and TdT enzyme at 37 °C for 1 hour, and then treated with the converter conjugated with horseradish peroxidase at 37 °C for 30 minutes. Under the fluorescence microscope (Carl Zeiss, Jena, Germany), cells with green stained nuclei were regarded as TUNEL-positive and expressed as the percentage of total cells. Finally, TUNEL-positive cells were counted in 10 randomly selected fields (× 200) in a blinded manner.
Electronic microscopy
The renal samples at 1 mm3 were fixed with 2.5% glutaraldehyde overnight at 4 °C, and treated with osmium tetroxide, embedded and sliced. Autophagosome ultrastructure was observed under the transmission electron microscope (Olympus).
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA of renal tissues or tubular cells from each group of rats was extracted by TRIzol reagent (Invitrogen). After the concentration and purity of RNA were determined, cDNA was synthesized by a reverse transcription kit, amplified by PCR instrument, and the expression of each primer in (Table 1) was detected by a SYBR PCR Master Mix kit (Bio-Rad, Inc., Hercules, CA, USA), with U6 or β-actin as an internal reference. All primers used in the experiment were designed by Primer 3Plus website and synthesized by Genewiz Biotechnology Co., Ltd. (Suzhou, Jiangsu, China). The experiment was repeated 3 times to calculate the average CT value, and the concentration of each sample was calculated according to 2−△CT to detect the relevant RNA level in cells and tissues.
Table 1
Primer sequences for RT-qPCR
Primer | Sequence (5’→3’) |
TUG1 | F: GCTATTGGTATGGCTGGCCT |
R: AAGGAGAGAAATGGACGCGG |
CHCHD4P4 | F: TGACCCCACCTCTTCTTTGG |
R:AGACATTAACTGGAACCGTCC |
AU015836 | F: GCCTCCCAGCCATTAGGTTT |
R: GCCACCGTGTAGAGGTCAAA |
MALAT1 | F: CAGCAGCAGACAGGATTCCA |
R: ATTGCCGACCTCACGGATTT |
HIF1A-AS1 | F: TGGATGCCCACATGCATTATGA |
R: AGCAAGGGCTGTTCCATGTT |
PVT1 | F: GGGGAATAACGCTGGTGGAA |
R: CCCATGGACATCCAAGCTGT |
PTEN | F: GTGCAGATAATGACAAG |
R: GATTTGACGGCTCCTCT |
β-actin | F: GTCATTCCAAATATGAGAGATGCGT |
R: GCTATCACCTCCCCTGTGTG |
miR-29 | F: TGCCAGGAGCTGGTGATTTCCT |
R: ACGGGCGTACAGAGGATCCCC |
U6 | F: AACGCTTCACGAATTTGCGT |
R: GGTGTACTCTTGGGGAACCAG |
Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; TUG1, taurine upregulated gene 1; PTEN, phosphatase and tensin homolog; miR-29, microRNA-29; F, forward; R, reverse. |
Western blot analysis
The renal tissues were homogenized centrifuged at 12,000 g for 10 minutes at 4 °C. Then proteins were collected and quantified using a bicinchoninicacid kit (Thermo Fisher Scientific, Rockford, IL, USA), and then separated by electrophoresis and transferred onto nitrocellulose membranes. The blots were blocked with 5% non-fat dry milk in tris-buffered saline-tween (TBST) at 37 °C for 2 hours, followed by incubation with primary antibodies at (Table 2) 4 °C overnight. After TBST washes, the membranes were incubated for 1 hour with horseradish-peroxidase conjugated secondary antibody. After TBST washes, protein bands were detected by an enhanced chemiluminescence system and visualized using the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA). Target protein/glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as relative protein expression.
Table 2
Antibodies used in experiment
Antibody | Information | Dilution rate |
Bax | ab32503, ABcam | 1/1000 |
Bcl-2 | ab182858, ABcam | 1/2000 |
p62 | ab91526, ABcam | 2 µg/mL |
Becline-1 | ab207612, ABcam | 1/2000 |
LC3II | ab48394, ABcam | 2 µg/mL |
LC3I | ab51520, ABcam | 2 µg/mL |
PTEN | ab32199, ABcam | 1/10000 |
GAPDH | ab181602, ABcam | 1/10000 |
Note: Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X; LC3, light chain 3; PTEN, phosphatase and tensin homolog; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. |
RNA pull-down
TCMK-1 cells were transfected with biotinylated miR, and were collected after 48-hour transfection. The cell lysates were incubated with M-280 streptavidin magnetic beads (Invitrogen). The bound RNAs were purified using TRIzol reagent (Invitrogen) for further RT-qPCR analysis.
Dual luciferase reporter gene assay
TUG1 and phosphatase and tensin homolog (PTEN) 3’untranslated region (3’UTR) sequences containing miR-29 binding site were synthesized respectively, followed by construction of TUG1 and PTEN 3’UTR wild type (WT) plasmids. Then the constructed plasmids were respectively transfected with NC and miR-29 plasmids into 293T cell (ATCC, Manassas, Virginia, USA). After 48 hours of transfection, cells were collected and lysed. Luciferase activity was detected by a luciferase detection kit (BioVision, SanFrancisco, CA, USA) and Glomax20/20 luminometer (Madison, Wisconsin, USA).
Cell culture and grouping
TCMK-1 cells purchased from ATCC (CCL-139™) were cultured in Dulbecco modified Eagle medium (HyClone, Logan, UT, USA) with 10% heat-inactivated fetal bovine serum (FBS, HyClone). For hypoxia treatment, TCMK-1 cells were incubated in Forma Series II Water Jacketed CO2 incubator (Thermo) containing 94% N2 and 5% CO2 to maintain the oxygen concentration at 1%. During reoxygenation incubation, cells were removed to a normoxic chamber (21% O2).
Cells were allocated into blank group (in the normoxic chamber at indicated time points), hypoxia/reoxygenation (H/R) group (cells were treated with H/R), NC group (after H/R treatment, cells were treated with empty vectors), and si-TUG1 group (after H/R treatment, cells were treated with si-TUG1, at 50 nM) [18]. All transfections were done with HiPerFect transfection reagent (QIAGEN, Valencia, CA, USA).
Cell counting kit-8 (CCK-8)
Cell viability was detected by a CCK-8 kit (Dojindo Laboratories, Kumamoto, Japan) according to the instructions. The absorbance at a wavelength of 450 nm was measured using a microplate reader. The percentage of living cells was calculated by the ratio of absorbance of the H/R group to that of the blank group.
Flow cytometry
Cells were planted into 6-well plates at 5 × 105/mL cells/well and 1 mL/well. After cell adherence for 24 hours, cells were stimulated by hypoxia and H/R in refreshed medium. Cells in each group were collected into flow tubes, and each tube was added with 5 uL fluorescein isothiocyanate-labeled Annexin-V buffer and 100 uL 1 × loading buffer, followed by 30-nimute incubation without light exposure. Cell apoptosis was detected by a flow cytometer (Beijing YourHope Medical Equipment Co., Ltd., Beijing, China).
Statistical analysis
Statistical analysis was conducted by SPSS 21.0 (IBM Corp. Armonk, NY, USA). All the data were in normality distribution checked by the Kolmogorov-Smirnov test. Measurement data were expressed as mean ± standard deviation. The t test processed comparisons between two groups, while one-way or two-way analysis of variance (ANOVA) processed comparisons among multiple groups, and Tukey's multiple comparisons test or Sidak's multiple comparisons test was used for post-hoc test. The Kaplan-Meier method was used to draw the survival curve. The p value was obtained by a two-tailed test and p < 0.05 indicated a statistical difference.