Conditional Knockout of PDK1 in Osteoclasts Suppressed Osteoclastogenesis and Ameliorated Prostate Cancer-Induced Osteolysis

doi:10.21203/rs.3.rs-996081/v1

Download PDF

Primary research

Conditional Knockout of PDK1 in Osteoclasts Suppressed Osteoclastogenesis and Ameliorated Prostate Cancer-Induced Osteolysis

https://doi.org/10.21203/rs.3.rs-996081/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background: The development and maintenance of normal bone tissue is supported by balanced communication between osteoblasts and osteoclasts. The invasion of cancer cells disrupts this balance, leading to osteolysis. As the only bone resorption cells in vivo, osteoclasts play important roles in cancer-induced osteolysis. However, the function of 3-phosphoinositide–dependent protein kinase-1 (PDK1) in osteoclast resorption remains unclear.

Methods: In our study, we used a receptor activator of nuclear factor-kappa B (RANK) promoter‐driven Cre‐LoxP system to conditionally delete the PDK1 gene in osteoclasts in mice. We investigated the impact of Osteoclast‐specific knockout of PDK1 on prostate cancer-induced osteolysis. Bone marrow-derived macrophage cells (BMMs) were extracted and induced to differentiate osteoclasts in vitro to examine the function of PDK1 in osteoclasts.

Results: In this study, we found that PDK1 conditional knockout (cKO) mice exhibited smaller body sizes when contrasted with the wild-type (WT) mice. Moreover, deletion of PDK1 in osteoclasts ameliorated osteolysis and reduced bone resorption markers in the murine model of prostate cancer-stimulated osteolysis. In vivo, we discovered that osteoclast‐specific knockout of PDK1 suppressed RANKL-stimulated bone resorption function, osteoclastogenesis, and osteoclast-specific gene expression (Ctsk, TRAP, MMP-9, NFATc1). Western blot analyses of RANKL-induced signaling pathways showed that conditional knockout of PDK1 in osteoclasts inhibited the early nuclear factor κB (NF-κB) activation, which consequently suppressed the downstream induction of NFATc1.

Conclusion: These findings demonstrated that PDK1 performs an instrumental function in osteoclastogenesis and prostate cancer-induced osteolysis by modulating the PDK1/AKT/NF-κB signaling pathway.

Cancer Biology

Oncology

PDK1

prostate cancer

invasion

osteoclastogenesis

osteolysis

Bone tissue is the commonest site of metastatic prostate cancer and breast cancer, and 70% of patients with metastatic prostate cancer have bone metastasis^[1]. Once cancer cells invade the bone, patients are rarely cured and metastatic lesions can cause complications, such as pain, neurospinal cord compression, bone fractures, and hypercalcemia^[2]. Additionally, hospitalization for skeletal-related events (SREs) increases the financial burden of patients^[3]. Osteoblasts and osteoclasts coordinate with one another to form stable bone remodeling. The invasion of cancer cells leads to the imbalance of homeostasis and ultimately to the destruction of bone, while changes in the bone microenvironment will further enhance the growth of cancer cells, forming a vicious cycle^[4]. Osteoclast inhibitors mitigate SREs associated with bone metastasis^[5], including bisphosphonates and denosumab, which are commonly used in clinical practice. Although these two osteoclast inhibitors exert some effect in clinical treatment, neither has affected survival outcomes ^[6]. Additionally, continuous and increased use may lead to long bone atypical fractures, osteonecrosis of the mandible, and infection risks^{[7, 8]}. Therefore, it is of great importance to further develop effective drugs to reduce the incidence of SREs associated with bone metastasis in cancer.

An osteoclast is known to be a multinucleated and large cell, which is differentiated from macrophage/monocyte lineage cells by the receptor activator of nuclear factor-κB ligand (RANKL) and macrophage colony-stimulating factor (M-CSF)^[9]. The binding of RANK to RANKL activates the nuclear factor of activated T cell cytoplasmic 1 (NFATc1), a key modulator of the formation of osteoclast, further inducing the osteoclast-associated gene expression, including matrix metalloproteinase-9 (MMP-9), cathepsin K (Ctsk), and tartrate-resistant acid phosphatase (TRAP) ^{[10, 11]}.

The NF-κB signaling pathway is a critical pathway in the differentiation of osteoclast. Many research reports have demonstrated that suppression of the NF-κB signaling pathway inhibits osteoclast formation and function^[12-14]. The 3-phosphoinositide–dependent protein kinase 1 (PDK1) gene was first recognized as an essential upstream lipid kinase of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) cascade in insulin signal transduction. Activation of AKT through phosphorylation triggers a cascade that further activates AKT downstream factors^[15]. Most studies on PDK1 have focused on its relation to tumors^[16]; thus, the role of PDK1 in osteoclast formation remains unclear.

Osteoclasts, as the only bone resorptive cells in vivo, play important roles in osteolysis induced by tumors. Tumor cells in the bone microenvironment secrete several cytokines that trigger osteoclast activity, which in turn increases various lymphocytokines and growth factors that stimulate the tumor cells proliferation^[17]. Interestingly, recent research reports have demonstrated that F2r reacts to RANKL activation and impedes osteoclastogenesis by suppressing both the F2r-NF-κB and F2r-AKT signaling pathways^[18]. Moreover, research has shown that stachydrine inhibiting osteoclastogenesis via AKT signaling prevents LPS-induced bone loss^[19]. Since PDK1 is an upstream activating element of AKT, we hypothesized that PDK1 would affect bone resorption and the formation of osteoclast through the AKT/NF-κB pathway.

Materials and reagents

Fetal bovine serum (FBS), FITC‐conjugated phalloidin and DAPI stain, IRDye fluorescent-labeled secondary antibodies, and alpha modification of Eagle minimal essential medium (α‐MEM) were procured from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). The TRAP staining kit and cell counting kit‐8 (CCK-8) were procured from Sigma‐Aldrich (St. Louis, MO, USA). ELISA kits against CTX‐1, TRACP‐5b, BGP, and PINP were procured from Cusabio Biotech (Wuhan, China). RANKL and M-CSF were bought from R&D Systems (Minneapolis, MN, USA). The specific primary antibodies, including PDK1 (rabbit, cat. no.: 5662S), p-AKT (phosphor T308; rabbit, cat. no.: 13038S), AKT (rabbit, cat. no.: 4685S), p-IκBα (rabbit, cat. no.: 2859S), IκBα (rabbit, cat. no.: 4812S), p-P65 (phosphor Ser536; rabbit, cat. no.: 3033S), P65 (rabbit, cat. no.: 8242S), RANK (rabbit, cat. no.: 4845S), and NFATC1 (rabbit, cat. no.: 5861S) were procured from Cell Signaling Technology (Danvers, MA, USA). The specific primary antibody, Ctsk (rabbit, cat. no.: ab187647), was purchased from Abcam (Cambridge, UK).

Generation and identification of PDK1-cKO (RANK^Cre. PDK1^flox/flox) mice

PDK1^flox/flox and RANK^Cremice were designed by GemPharmatech (Nanjing, China). Cre recombinase expression was regulated via RANK promoter transcriptional control. PDK1^flox/flox and RANK^Cre mice were mated to produce RANK^Cre. PDK1^flox/+ mice. RANK^Cre. PDK1^flox/+ and PDK1^flox/flox were mice mated to produce PDK1-cKO (RANK^Cre. PDK1^flox/flox) and wild-type (WT) (PDK1^flox/flox) mice (Fig. 1A). Mice were kept in individually ventilated cages (temperature: 22–26°C; humidity: 50–60%; dark/light: 12/12 hours) with free to eat standard feed and freshwater. Mice were numbered with ear tags 2 weeks after birth. Rat tails were cut into 1 mm segments for PCR. DNA was acquired utilizing a TIANamp genomic DNA extraction kit (TIANGEN Biotech, Beijing, China) as per the instructions stipulated by the manufacturer. Primers were provided by Shanghai Sangon Biological Engineering Technology (Shanghai, China) (Table 1). The PCR reaction system was as follows: 25 μL 2× Tag MasterMix, 2 μL primer F, 2 μL primer F, 1 μL template, and 20 μL ddH₂O. The PCR reaction conditions were set according to the 2× Tag MasterMix instructions (Shanghai Sangon Biological Engineering Technology, Shanghai, China). The PCR products were used for horizontal agarose gel electrophoresis (Fig. 1B). Mice were weighed weekly and weights were recorded. All of the animal experimentations were undertaken in compliance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020). Mice were anesthetized via of 2% sevoflurane in a special container, CO₂ was then injected into the container at a rate that replaced 25% of container volume per minute. When it was confirmed that the mice were dead, the CO₂ was turned off. The execution dates ranged from November 2019 to May 2021.

Alizarin Red and Alcian Blue staining to visualize mice skeletons

At 8 weeks, WT and PDK1-cKO mice were euthanized, placed on a foam board in a prone position, and photographed utilizing an X-ray imager (Faxitron MX20/DC2; voltage: 5.0 KV; time of exposure: 6.0 s). Mice were observed for skeletal deformities and variation and then dissected after photography. The main viscera were dissociated to observe whether there was any variation. The whole skeleton was carefully dissociated and muscle tissue was removed as much as possible, and then the skeleton was fixed in 95% alcohol for 3 d, which was then digested in acetone for 48 h to remove excess adipose tissue. The skeleton was stained with pre-configured staining solution for 5 d (75% alcohol: 0.3% Alcian Blue: 0.1% Alizarin Red: glacial acetic acid = 1:1:1:17). After staining, the skeleton was transferred to 1% KOH and soaked for 48 hours, and then placed to different solutions for 24 hours (glycerol: 1% KOH = 1:4; glycerol: 1% KOH = 1:1; glycerol: 1% KOH = 4:1). After the muscle tissue was transparent, the staining results were observed.

Murine model of prostate cancer-induced osteolysis

Anesthetization of eight‐week-old PDK1-cKO and WT mice (n = 6) was done by inhalation of sevoflurane and preoperative IP injection of penicillin (200 U/g) to avoid infections. The needle was injected into the proximal tibia head of the right lower extremity with a microsyringe, then rotated 2–3 mm. A 10 μL cell suspension containing 5×10⁵ RM-1 was slowly injected, then the syringe was removed, the site was disinfected with iodophor, and mice were placed back into their cages after waking up. After 2 weeks, the tibia of the right lower limb was fixed in 4% paraformaldehyde for micro-CT detection.

Detection of bone conversion markers

Eight‐week-old mice venous blood was harvested and centrifugated for 20 minutes at 1600 rpm. Bone formation markers (PINP, BGP) and bone resorption markers (TRAC-5b, CTX-I) were detected using an ELISA kit (Wuhan Huamei Biological Engineering Co., Ltd., Wuhan, China) as per the instructions stipulated by the manufacturer.

Micro-CT scanning and 3D reconstruction of the tibia

Two weeks after the murine model of prostate cancer-induced osteolysis was established, the right tibia was taken for scanning and 3D reconstruction was conducted using a micro‐CT scanner (SkyScan1072) (voltage: 70 KV; current: 200 μA; resolution: 10 μm). The osteolysis area was randomly selected for quantitative analysis. The main analysis indexes were structure model index (SMI), connectivity density (Conn‐Dens, 1 mm³), trabecular separation (Tb. Sp, μm), trabecular thickness (Tb. Th, μm), trabecular number (Tb. N, 1 mm), and bone volume to tissue volume (BV/TV, %).

TRAP and HE staining of the tibial bone

After micro-CT scanning, the tibial bones were decalcified in 10 percent ethylenediaminetetraacetic acid (EDTA) for a fortnight at a temperature of 4°C ensued by continuous dehydration in 40 percent, 75 percent, and 95 percent ethanol for 60 minutes, followed by two dehydrations in 100 percent ethanol with each for 30 min. Tissue specimens were cleared in xylene for 15 minutes before being infiltrated with paraffin for 3 hours. The sequential segments were split into 5 μm slices, followed by staining with HE and TRAP, and subsequently visualized utilizing an inverted light microscope (Nikon Eclipse TS100, Tokyo, Japan).

Bone marrow-derived macrophage cell extraction and osteoclast differentiation

Eight-week-old PDK1-cKO and WT mice were euthanized. The intact femur and tibia were isolated after disinfection in 75% alcohol for 5 min. The ends of the femur and tibia were cut off, the α-MEM was drained with a 1 mL syringe, and the bone marrow cavity was rinsed 3 times. The collected rinse solution was sieved with a 200 μm sterile filter, then the supernatant was discarded and subjected to suspension in α-MEM comprising 10 percent FBS and M-CSF (25 ng/mL). The medium was transferred to a T-75 culture flask and subjected to culturing at a temperature of 37°C with a CO₂concentration of 5%. The α-MEM comprising 10 percent FBS and M-CSF (25 ng/mL) was replaced at a frequency of once every two days. After 4 days, several bone marrow-derived macrophage cells (BMMs) were observed, which were digested and suspended in α-MEM with 10 percent FBS and M-CSF (25 ng/mL). BMMs were kept in 96-well plates (8000/well), then subsequently placed in a cell incubator for culturing. After 24 h, the α-MEM comprising 10 percent FBS, RANKL (100 ng/mL), and M-CSF (25 ng/mL) was used to replace the medium. Roughly 6 d after RANKL induction, multinucleated osteoclasts were observed under a microscope. After discarding the medium, rinse operation was down two times using PBS, and then 4% paraformaldehyde was added for fixation at room temperature (RT) for 30 min. The fixative was subsequently discarded and washing routine was conducted twice with PBS, and TRAP dye was added at RT for 1 h. Then, the TRAP dye was discarded, followed by two-time rinse using PBS and air seasoning. Finally, pictures were taken and the number of osteoblasts was calculated.

BMMs proliferation/viability assay

BMMs of PDK1-cKO and WT mice were plated in 96-well plates (6000/well) and subjected to culturing in α-MEM comprising M-CSF (25 ng/mL). Then, after 48hours, each well was added 10 μL CCK-8, followed by incubation at a temperature of 37°C for 2 hours, and values recording of OD at 450 nm utilizing a microplate reader. The proliferation activity of PDK1-cKO and WT mice was statistically analyzed according to the OD value.

Podosome actin belt formation assay

BMMs were put in 96-well plates (8×10³/well) to induce mature osteoclasts (same induction process as described above). When mature osteoclasts were observed, cells were gently rinsed twice using 1× PBS, fixed using percent paraformaldehyde at RT for 10 minutes, and rinsed thrice using 1× PBS; then cells were permeated using 0.1 percent Triton X-100 in PBS for 5 min at RT, blocked using percent BSA in PBS for 30 minutes, rinsed 2 times with 0.2 percent BSA, diluted with rhodamine-conjugated phalloidin in 0.2 percent BSA (1:100), incubated for 1 hour at RT, rinsed 4 times using 0.2 percent BSA and 4 times using 1× PBS, and stained using DAPI for 5 minutes. Lastly, photos were taken under a fluorescence microscope (Life Technologies, Carlsbad, CA, USA). The data were evaluated utilizing ImageJ (NIH, Bethesda, Maryland, USA).

Hydroxyapatite resorption assay

BMMs were placed in 6-well plates (2×10⁴/well) and induced with α-MEM comprising 10 percent FBS, RANKL (100 ng/mL), and M-CSF (25 ng/mL). When the round-like preosteoclasts were observed under a microscope, they were digested with 0.25% trypsin and placed in a 96-well hydroxyapatite-coated bone absorption plate (2000/well). After 3 d of culturing, the hydroxyapatite coating was absorbed into a transparent area with irregular shape and the culture medium was sucked out. Wells were washed with 1× PBS 3 times and washed with 5% sodium hypochlorite solution for 10 minutes to eliminate the remaining adherent cells. Finally, hydroxyapatite-coated bone absorption plates were washed using 1× PBS thrice, visualized using an inverted microscope, and photographed after air drying. The absorption area was measured using ImageJ (NIH, Bethesda, Maryland, USA).

Quantitative real-time PCR (qPCR)

The total RNA from PDK1-cKO and WT osteoclasts was obtained utilizing a TaKaRa MiniBEST universal RNA extraction kit (Takara Bio Inc, Kyodo, Japan) as per the protocol stipulated by the manufacturer. The reverse transcription of RNA into cDNA was performed. The acquired cDNA was utilized as a template for qPCR, which was carried out on an ABI Prism 7500 system (Thermo Fisher Scientific, Waltham, MA). The PCR cycling setting was as illustrated below: 95°C for 30 seconds; 40 cycles at 95°C for 5 seconds; and 60°C for 34 seconds. Table 1 lists the primers utilized in this research. The relative gene expression was evaluated utilizing the 2^-^ΔΔ^Ct method.

Western blot analysis and protein extraction

To investigate the impacts of conditional knockout of the PDK1 gene on the early activation of RANKL signaling pathways, BMMs were treated with serum-free starvation for 3 hours and subsequently triggered with RANKL (100 ng/mL) for 5, 10, 20, 30, or 60 min. To evaluate the effects of conditional knockout of PDK1 on the late RANKL activated signal cascade, BMMs were triggered with RANKL (100 ng/mL) for 0, 2, 4, or 6 d; WT mice were used as the control. Total cellular proteins (TCPs) were obtained utilizing a TCP extraction kit (Sigma-Aldrich, St. Louis, MO, USA) as per the protocols stipulated by the manufacturer. TCPs were isolated by 10 percent SDS-PAGE gel and loaded onto nitrocellulose membranes (Thermo Fisher Scientific, Shanghai, China). Blocking of the membranes was done with 5 percent skim milk in 1× TBST for 1 hour at RT, followed by incubation using primary antibodies (for the dilution ratio, refer to the reagent instructions) for 15 h at 4°C, and three-time rinse with 1× TBST. Afterward, membranes were subjected to incubation with IRDye fluorescent-labeled secondary antibodies at RT for 1 h. The corresponding protein bands were imaged using an LI-COR Odyssey SA Infrared Imaging Scanner. Densitometric analyses were measured using ImageJ (NIH, Bethesda, Maryland, USA).

Statistical analyses

All of the data are presented as the mean ± standard deviation (SD). All the experimentions conducted in this study were replicated thrice unless otherwise noted. Statistical differences were determined using SPSS v22.0 (SPSS Inc., Chicago, IL, USA). To compare the two groups, an unpaired Student's t-test was employed. The significance threshold was P < 0.05.

Effects on mice phenotypes after PDK1 deletion in osteoclasts

Previous studies have shown that the whole-body PDK1 knockout gene in mice contributes to early embryonic death^[20]. Therefore, in this study, we established a mouse model for the conditional PDK1 knockout in osteoclast cells. To evaluate the effects on the growth and development of mouse bone after PDK1 deletion in osteoclasts, we monitored skeleton size and body weight. Results revealed that, when compared to WT mice, PDK1-cKO mice had smaller skeleton development and lower body weight after 5 weeks and onwards. The difference in body weight between the 2 groups was significant (P < 0.05) and no malformations were detected in the bone or vital organs of PDK1-cKO mice (Fig. 2A–G). To determine the functional level of osteoblasts and osteoclasts in vivo, we detected the contents of bone turnover markers in 8-week-old mice’s serum. Results revealed that bone resorption markers (TRAC5b, CTX-1) of PDK1-cKO mice were significantly reduced when compared to WT mice (P < 0.01). However, there were no considerable variations between the contents of bone formation markers (P1NP, BGP) (Fig. 2H, P > 0.05).

Osteoclast‐specific knockout of PDK1 ameliorated prostate cancer-stimulated osteolysis in vivo

To evaluate the impacts of osteoclast‐specific knockout of PDK1 on prostate cancer-stimulated osteolysis, we established a mice model of prostate cancer-induced osteolysis. Results revealed that there was no considerable variation in tumor mass between WT and PDK1-cKO mice (Fig. 3A, B, P > 0.05). However, osteolysis in PDK1-cKO mice was reduced when contrasted with WT mice (Fig. 3E). Additional analysis of bone parameters showed that when compared to WT mice, BV/TV, Tb. Th, Tb. N, and Conn-dens. significantly increased (Fig. 3C, D, F, G, P < 0.05), whereas Tb. Sp and SMI reduced (Fig. 3I, J, P > 0.05). In the bone tissue sections, the number of trabeculae in PDK1-cKO mice was higher than in WT mice after HE staining; this result is consistent with the bone parameter analysis. Moreover, the amount of TRAP-positive osteoclasts in PDK1-cKO mice was lesser as opposed to that in WT mice after TRAP staining (Fig. 3H).

Osteoclast‐specific knockout of PDK1 suppressed RANKL-induced osteoclastogenesis, podosome belt formation, and bone resorption function in vitro

To explore the impacts of osteoclast‐specific knockout of PDK1 on the proliferation activity of BMMs, after 48 h of M-CSF stimulation, we examined the proliferative activity of BMMs. Results revealed that there was no considerable variation between WT and PDK1-cKO mice (Fig. 4A, P > 0.05). To further explore the effects of osteoclast‐specific knockout of PDK1 on RANKL-induced osteoclastogenesis, on the sixth day of RANKL induction, TRAP staining was applied to mature osteoclasts. Results revealed that conditional knockout of PDK1 in osteoclasts inhibited the differentiation of RANKL‐induced osteoclasts (Fig. 4B). The count of TRAP‐positive multinucleated cells (n ≥ 3) in PDK1-cKO mice was lesser as opposed to that in WT mice (Fig. 4C, P < 0.001). To examine morphological alterations and podosome belt formation, mature osteoclasts were subjected to staining with rhodamine-phalloidin. When compared to WT mice, there were smaller osteoclasts with fewer nuclei in PDK1-cKO mice (P < 0.001), suggesting that the knockout of PDK1 in osteoclasts inhibited precursor cell fusion (Fig. 4D–F).

Given that osteoclast‐specific knockout of PDK1 impaired the formation of podosome actin belt, which is a precondition for osteoclast function, we postulated that osteoclast‐specific knockout of PDK1 would also inhibit osteoclast bone resorption. We used hydroxyapatite-coated bone absorption plates to explore whether the deletion of PDK1 in osteoclasts would have an effect on osteoclast resorption function. Results revealed a smaller resorption area after PDK1 deletion in osteoclasts (Fig. 4G, H, P < 0.001). These findings indicated that the PDK1 deletion in osteoclasts can effectively inhibit osteoclast bone resorption function.

Conditional PDK1 knockout in osteoclasts inhibited osteoclast-specific gene expression

Upon the stimulation of osteoclast differentiation during BMM differentiation in osteoclasts, several osteoclast-specific genes (Ctsk, TRAP, MMP-9, NFATc1) are upregulated in BMMs^{[21, 22]}. To further explore the underlying mechanisms, the osteoclast-specific genes expression was examined at the mRNA level. Results revealed that, when compared to WT mice, the relative expression levels of Ctsk, TRAP, MMP-9, and NFATc1 were considerably inhibited in PDK1-cKO mice (Fig. 5A, P < 0.01).

Deletion of PDK1 in osteoclasts suppressed the RANKL-stimulated NF-κB signaling pathway

The NF-κB pathway is the main signaling pathway triggered during osteoclast formation^[23]. To investigate the mechanisms that underly the suppression impacts of the osteoclast‐specific knockout of PDK1 on early osteoclastogenesis, the NF-κB signaling pathways in osteoclasts were identified by Western blot analysis. Seeding of the BMMs was done on 6-well plates and cultured over the night to enable cells to attach to the wall. Then, the cells were activated by RANKL for 0, 5, 10, 30, or 60 min, TCPs were extracted, and the expressions of p-AKT, AKT, P65, p-P65, IκBα, and p-IκBα were examined. Results revealed that when compared to WT mice, p-AKT/AKT, p-I κBα/IκBα, and p-P65/P65 declined in PDK1-cKO mice (Fig. 5B, C, E, F,). To better examine the mechanisms that underly the suppression effects of osteoclast‐specific knockout of PDK1 on late osteoclastogenesis, TCPs were extracted after BMMs were induced by RANKL for 0, 2, 4, or 6 d. Results revealed that, when compared to WT mice, PDK1, Ctsk, RANK, and NFATc1 protein expression was considerably inhibited in PDK1-cKO mice (Fig. 5D, G–J).

Bone metastasis is clinically difficult to treat due to pain, increased SREs, decreased quality of life, and decreased overall survival, and there is currently no effective treatment^[24]. Approved therapeutic agents for treating bone metastasis in the 2019 National Comprehensive Cancer Network (NCCN) Clinical Practice Guidelines in Oncology focus on the treatment of obvious pain and SREs. These drugs mainly include bisphosphonates, which inhibit the bone resorptive function of osteoclasts by triggering apoptosis, and denosumab, which is a RANKL-specific inhibitor that inhibits osteoclast activation and development, reduces bone resorption and increases bone mineral density^[25]. Although phosphates are now widely used in clinical practice, there is a risk of osteonecrosis and potential esophageal tumors after long-term use^[26]. Therefore, identifying novel bone‑protective mechanisms is a pertinent area of research. Activated osteoclasts play key roles in tumor-related bone destruction through bone resorption^[27]. RANKL produced by tumor cells stimulates osteoclast precursor cells to differentiate osteoclasts^{[28, 29]}, which thereby activates osteoclasts, further providing a suitable bone microenvironment for tumor growth^{[30, 31]}. Thus, the inhibition of osteoclasts is an important research direction for reducing SREs.

The present study demonstrated that the osteoclast‐specific knockout of PDK1 ameliorated prostate cancer-induced osteolysis and reduced bone resorption markers in the blood in vivo. There was no considerable alteration in tumor mass; however, the activation of osteoclasts stopped the dormancy of tumor cells and promoted their growth^{[30, 32]}. A possible explanation for this result is that the inhibition of osteoclasts was mainly manifested due to certain conditions within the bone microenvironment. The proliferation of tumor cells resulted in tumor tissue covering the tibia, then the diameter of the tumor far exceeded the diameter of the tibia, and osteoclasts were confined to bone tissue; thus, the inhibition of osteoclasts did not change tumor weight. In this research, we found that the conditional knockout of PDK1 in osteoclasts in vivo led to smaller body size of mice. We used a RANK promoter‐driven Cre‐LoxP system to conditionally delete the PDK1 gene in osteoclasts. When cells expressed RANK, Cre recombinase knocked out PDK1. However, RANK is not specific to the expression of osteoclasts and other cells are expressed in a small amount^{[33, 34]}. Therefore, the small size of mice is likely due to the knockout of PDK1 in other cells. Another surprising finding was that that the TRAP-positive osteoclast-like cells in tumor tissue were observed after histological TRAP-staining. This result is likely due to the scattered tumor-associated macrophages that were differentiated into osteoclasts under the activation of RANKL secreted by tumor cells, which is consistent with the observation of osteoclast-like cells in the soft tissue of leiomyossarcoma by Gibbons et al.^[35].

In this study, it was verified in vitro that the osteoclast‐specific knockout of PDK1 suppressed RANKL-stimulated osteoclastogenesis, osteoclast-specific gene expression, and bone resorption function but the proliferation of BMMs was not affected. This result may be due to the RANK promoter‐driven Cre‐LoxP system that conditionally deleted the PDK1 gene in osteoclasts. When cells expressed RANK, Cre recombinase knocked out PDK1; without RANKL stimulation, BMMs rarely expressed RANK. At this time, PDK1 was not knocked out or was rarely knocked out in osteoclasts. Further investigation of the molecular mechanisms demonstrated that the deletion of PDK1 in osteoclasts inhibited osteoclastogenesis via the RANKL-stimulated NF-κB signaling pathway (Fig. 6).

Osteoclasts are the only cells derived from macrophage/monocyte lineage cells with bone absorption functions in the body^[36]. The proliferation, differentiation, and activation of osteoclasts require the participation of M-CSF and RANKL. MCS-F stimulates BMMs that become osteoclast precursors, and the RANKL binding to its receptor, RANK, stimulates the differentiation of osteoclast precursors into osteoclasts^[37]. The NF-κB signaling pathway is an essential pathway for the differentiation of osteoclast. RANK signals recruit tumor necrosis factor receptor-associated factor 6 (TRAF6), which activates the mitogen-activated protein kinases (MAPKs), NF-κB and activator protein-1 (AP-1), which activate NF-κB that induces NFATc1, a key osteoclastogenesis regulator^{[38, 39]}. PDK1 expression is dysregulated in many cancer types and is an interesting and unexplored target for cancer therapy^{[15, 40]}. The PDK1 protein activates the PI3K-AKT pathway. Previous studies demonstrated that AKT actives the NF-κB signaling pathway in tumor cells^{[41, 42]}. AKT has also been found to enhance osteoclast formation and osteolysis in osteolysis-related diseases^[43]. Our study demonstrated that PDK1 can further activate the NF-κB signaling pathway in osteoclasts by activating AKT. These results suggested that targeting the PDK1 gene in osteoclasts might be a good treatment approach for prostate cancer-related osteolysis.

In our animal model, instead of injecting tumor cells into the circulatory system, we injected tumor cells specifically into the tibia's bone marrow cavity. Although this did not mimic distant metastasis in tumor cells, it directly led to bone damage. We did not further verify the above experimental results through PDK1-specific inhibitors, as there is no PDK1-specific inhibitor for only osteoclasts on the market. Moreover, we were concerned that PDK1-specific inhibitors would affect tumor cells at the time of intervention and that we could not properly evaluate the function of PDK1 in osteoclasts.

To summarize, this research illustrated that the conditional knockout of PDK1 in osteoclasts ameliorated prostate cancer-induced osteolysis effectively by suppressing RANKL-stimulated bone resorption and osteoclastogenesis.

In general, our research indicated that conditional knockout of PDK1 in osteoclasts in vitro ameliorated prostate cancer-stimulated osteolysis. PDK1 deletion in osteoclasts in vivo suppressed osteoclast differentiation and bone resorption via the PDK1/AKT/NF-κB signaling pathway. These findings offer a new perspective for the treatment of prostate cancer-induced osteolysis.

PDK1, 3-phosphoinositide–dependent protein kinase-1; WT, wild type; cKO, conditional knock out; BMMs, bone marrow-derived macrophage cells; α-MEM, alpha modification of Eagle’s medium; BV/TV, bone volume/tissue volume; Tb. Th, trabecular thickness; M-CSF, macrophage colony stimulating factor; SMI, structural model index; Tb. Sp, trabecular separation; Tb. N, trabecular number; Conn-dens., connectivity density; Ctsk, cathepsin K; NFATc1, nuclear factor of activated T cells; micro-CT, microcomputed tomography; HE, hematoxylin and eosin; TBST, Tris-buffered saline-Tween 30; RANK, receptor activator for nuclear factor-κB; TRAP, tartrate-resistant acid phosphatase; NF-κB, nuclear factor κB; RANKL, receptor activator for nuclear factor-κB ligand;

Acknowledgments

Not applicable.

Author contributions

ZSF and ZGF designed the study; ZYN, NHB, and BYG conducted the experiments; ZQ and ZQ directed the study and evaluated the data; LMF and LP wrote the original manuscript. The final manuscript was reviewed and approved by all authors.

Funding

The National Natural Science Foundation of China (grant No.: 81860402), "139" Plan for training high-level medical backbone talents in Guangxi and the 22nd Batch of Guangxi Ten Hundred Thousand Talents Project funded this research.

Availability of data and materials

The corresponding author can provide datasets created in this work upon reasonable request.

Ethics approval and consent to participate

Approval of this research was granted by the Ethics Committee of Animal Experiment of Guangxi Medical University (Approval No. 201910027).

Consent for publication

Not applicable.

Competing interests

The authors comfirm that no interest conflict to declare.

Riquelme MA, Cardenas ER, Jiang JX: Osteocytes and Bone Metastasis. Frontiers in endocrinology 2020, 11:567844.
Fornetti J, Welm AL, Stewart SA: Understanding the Bone in Cancer Metastasis. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2018, 33(12):2099-2113.
Antczak C, Trinh VQ, Sood A, Ravi P, Roghmann F, Trudeau V, Chang SL, Karakiewicz PI, Kibel AS, Krishna N et al: The health care burden of skeletal related events in patients with renal cell carcinoma and bone metastasis. The Journal of urology 2014, 191(6):1678-1684.
Clézardin P: Pathophysiology of bone metastases from solid malignancies. Joint bone spine 2017, 84(6):677-684.
Hayes AR, Brungs D, Pavlakis N: Osteoclast inhibitors to prevent bone metastases in men with high-risk, non-metastatic prostate cancer: A systematic review and meta-analysis. PLoS One 2018, 13(1):e0191455.
Yee AJ, Raje NS: Denosumab for the treatment of bone disease in solid tumors and multiple myeloma. Future oncology (London, England) 2018, 14(3):195-203.
Beth-Tasdogan NH, Mayer B, Hussein H, Zolk O: Interventions for managing medication-related osteonecrosis of the jaw. The Cochrane database of systematic reviews 2017, 10(10):Cd012432.
Boquete-Castro A, Gómez-Moreno G, Calvo-Guirado JL, Aguilar-Salvatierra A, Delgado-Ruiz RA: Denosumab and osteonecrosis of the jaw. A systematic analysis of events reported in clinical trials. Clinical oral implants research 2016, 27(3):367-375.
Zhou L, Liu Q, Hong G, Song F, Zhao J, Yuan J, Xu J, Tan RX, Tickner J, Gu Q et al: Cumambrin A prevents OVX-induced osteoporosis via the inhibition of osteoclastogenesis, bone resorption, and RANKL signaling pathways. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2019, 33(6):6726-6735.
Ono T, Nakashima T: Recent advances in osteoclast biology. Histochemistry and cell biology 2018, 149(4):325-341.
Lorenzo J: The many ways of osteoclast activation. The Journal of clinical investigation 2017, 127(7):2530-2532.
Wu L, Luo Z, Liu Y, Jia L, Jiang Y, Du J, Guo L, Bai Y, Liu Y: Aspirin inhibits RANKL-induced osteoclast differentiation in dendritic cells by suppressing NF-κB and NFATc1 activation. Stem cell research & therapy 2019, 10(1):375.
Yin Z, Zhu W, Wu Q, Zhang Q, Guo S, Liu T, Li S, Chen X, Peng D, Ouyang Z: Glycyrrhizic acid suppresses osteoclast differentiation and postmenopausal osteoporosis by modulating the NF-κB, ERK, and JNK signaling pathways. European journal of pharmacology 2019, 859:172550.
Kim I, Kim JH, Kim K, Seong S, Kim N: Tusc2/Fus1 regulates osteoclast differentiation through NF-κB and NFATc1. BMB reports 2017, 50(9):454-459.
Gagliardi PA, Puliafito A, Primo L: PDK1: At the crossroad of cancer signaling pathways. Seminars in cancer biology 2018, 48:27-35.
Gagliardi PA, di Blasio L, Primo L: PDK1: A signaling hub for cell migration and tumor invasion. Biochimica et biophysica acta 2015, 1856(2):178-188.
Harvey HA, Cream L: Biology of bone metastases: causes and consequences. Clinical breast cancer 2007, 7 Suppl 1:S7-s13.
Zhang Y, Wang H, Zhu G, Qian A, Chen W: F2r negatively regulates osteoclastogenesis through inhibiting the Akt and NFκB signaling pathways. International journal of biological sciences 2020, 16(9):1629-1639.
Meng J, Zhou C, Zhang W, Wang W, He B, Hu B, Jiang G, Wang Y, Hong J, Li S et al: Stachydrine prevents LPS-induced bone loss by inhibiting osteoclastogenesis via NF-κB and Akt signalling. Journal of cellular and molecular medicine 2019, 23(10):6730-6743.
Lawlor MA, Mora A, Ashby PR, Williams MR, Murray-Tait V, Malone L, Prescott AR, Lucocq JM, Alessi DR: Essential role of PDK1 in regulating cell size and development in mice. The EMBO journal 2002, 21(14):3728-3738.
Asagiri M, Takayanagi H: The molecular understanding of osteoclast differentiation. Bone 2007, 40(2):251-264.
Miyamoto T: Regulators of osteoclast differentiation and cell-cell fusion. The Keio journal of medicine 2011, 60(4):101-105.
Boyle WJ, Simonet WS, Lacey DL: Osteoclast differentiation and activation. Nature 2003, 423(6937):337-342.
Zhang X: Interactions between cancer cells and bone microenvironment promote bone metastasis in prostate cancer. Cancer communications (London, England) 2019, 39(1):76.
Mohler JL, Antonarakis ES, Armstrong AJ, D'Amico AV, Davis BJ, Dorff T, Eastham JA, Enke CA, Farrington TA, Higano CS et al: Prostate Cancer, Version 2.2019, NCCN Clinical Practice Guidelines in Oncology. Journal of the National Comprehensive Cancer Network : JNCCN 2019, 17(5):479-505.
Lee SH, Chang SS, Lee M, Chan RC, Lee CC: Risk of osteonecrosis in patients taking bisphosphonates for prevention of osteoporosis: a systematic review and meta-analysis. Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA 2014, 25(3):1131-1139.
Weilbaecher KN, Guise TA, McCauley LK: Cancer to bone: a fatal attraction. Nature reviews Cancer 2011, 11(6):411-425.
Kim B, Kim H, Jung S, Moon A, Noh DY, Lee ZH, Kim HJ, Kim HH: A CTGF-RUNX2-RANKL Axis in Breast and Prostate Cancer Cells Promotes Tumor Progression in Bone. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2020, 35(1):155-166.
Henrich SE, McMahon KM, Plebanek MP, Calvert AE, Feliciano TJ, Parrish S, Tavora F, Mega A, De Souza A, Carneiro BA et al: Prostate cancer extracellular vesicles mediate intercellular communication with bone marrow cells and promote metastasis in a cholesterol-dependent manner. Journal of extracellular vesicles 2020, 10(2):e12042.
Yin JJ, Pollock CB, Kelly K: Mechanisms of cancer metastasis to the bone. Cell research 2005, 15(1):57-62.
Chen YC, Sosnoski DM, Mastro AM: Breast cancer metastasis to the bone: mechanisms of bone loss. Breast cancer research : BCR 2010, 12(6):215.
Tawara K, Oxford JT, Jorcyk CL: Clinical significance of interleukin (IL)-6 in cancer metastasis to bone: potential of anti-IL-6 therapies. Cancer management and research 2011, 3:177-189.
Nagy V, Penninger JM: The RANKL-RANK Story. Gerontology 2015, 61(6):534-542.
Blair JM, Zheng Y, Dunstan CR: RANK ligand. The international journal of biochemistry & cell biology 2007, 39(6):1077-1081.
Gibbons CL, Sun SG, Vlychou M, Kliskey K, Lau YS, Sabokbar A, Athanasou NA: Osteoclast-like cells in soft tissue leiomyosarcomas. Virchows Archiv : an international journal of pathology 2010, 456(3):317-323.
Udagawa N, Koide M, Nakamura M, Nakamichi Y, Yamashita T, Uehara S, Kobayashi Y, Furuya Y, Yasuda H, Fukuda C et al: Osteoclast differentiation by RANKL and OPG signaling pathways. Journal of bone and mineral metabolism 2021, 39(1):19-26.
Kodama J, Kaito T: Osteoclast Multinucleation: Review of Current Literature. International journal of molecular sciences 2020, 21(16).
Park JH, Lee NK, Lee SY: Current Understanding of RANK Signaling in Osteoclast Differentiation and Maturation. Molecules and cells 2017, 40(10):706-713.
Soysa NS, Alles N: NF-kappaB functions in osteoclasts. Biochem Biophys Res Commun 2009, 378(1):1-5.
Raimondi C, Falasca M: Targeting PDK1 in cancer. Current medicinal chemistry 2011, 18(18):2763-2769.
Xu X, Chen Y, Fu Q, Ni D, Zhang J, Li X, Lu S: The chemical diversity and structure-based discovery of allosteric modulators for the PIF-pocket of protein kinase PDK1. Journal of enzyme inhibition and medicinal chemistry 2019, 34(1):361-374.
Yang L, Hu X, Mo YY: Acidosis promotes tumorigenesis by activating AKT/NF-κB signaling. Cancer metastasis reviews 2019, 38(1-2):179-188.
Cao H, Zhu K, Qiu L, Li S, Niu H, Hao M, Yang S, Zhao Z, Lai Y, Anderson JL et al: Critical role of AKT protein in myeloma-induced osteoclast formation and osteolysis. The Journal of biological chemistry 2013, 288(42):30399-30410.

Table 1 Primers sequences for PCR.

Genes	Primers sequences (5′→3′)
PDK1	Forward	TGTGCTTGGTGGATATTGAT
PDK1	Reverse	AAGGAGGAGAGGAGGAATGT
RANK Cre	Forward	ACTTCTCCATGGTAGCCTCC
RANK Cre	Reverse	AATATGGGGGTGGGGTGATA
Ctsk	Forward	CTTCCAATACGTGCAGCAGA
Ctsk	Reverse	TCTTCAGGGCTTTCTCGTTC
TRAP	Forward	CACTCCCACCCTGAGATTTGT
TRAP	Reverse	CCCCAGAGACATGATGAAGTCA
MMP-9	Forward	CCTGTGTGTTCCCGTTCATCT
MMP-9	Reverse	ACCCGAATCTAGTAAGGTCGC
NFATc1	Forward	CCGTTGCTTCCAGAAAATAACA
NFATc1	Reverse	TGTGGGATGTGAACTCGGAA
β-Actin	Forward	TCTGCTGGAAGGTGGACAGT
β-Actin	Reverse	CCTCTATGCCAACACAGTGC

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Conditional Knockout of PDK1 in Osteoclasts Suppressed Osteoclastogenesis and Ameliorated Prostate Cancer-Induced Osteolysis

Archived Versions:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Archived Versions:

Version 1