ACE2-like carboxypeptidase B38-CAP protects from SARS-CoV-2-induced lung injury

doi:10.21203/rs.3.rs-124634/v1

Download PDF

Research Article

ACE2-like carboxypeptidase B38-CAP protects from SARS-CoV-2-induced lung injury

https://doi.org/10.21203/rs.3.rs-124634/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Nov, 2021

Read the published version in Nature Communications →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Angiotensin-converting enzyme 2 (ACE2) is a receptor for cell entry of SARS-CoV-2, and recombinant soluble ACE2 protein inhibits SARS-CoV-2 infection as a decoy. ACE2 is the carboxypeptidase to degrade angiotensin II (Ang II) to angiotensin 1-7 and improves the pathologies of cardiovascular disease and acute lung injury. To address whether the carboxypeptidase enzymatic activity of ACE2 is protective against COVID-19, we investigated the effects of B38-CAP, an ACE2-like enzyme, on SARS-CoV-2-induced lung injury. Expression of ACE2 protein was significantly downregulated in the lungs of SARS-CoV-2-infected hamsters. Recombinant S1 domain or receptor-binding domain (RBD) of the SARS-CoV-2 Spike protein also directly downregulated ACE2 expression and elevated Ang II levels and considerably worsened acid-induced lung injury in hamsters. Treatment with B38-CAP downregulated Spike RBD-induced high Ang II levels, severe inflammation and pulmonary edema through its ACE2-like enzymatic activity. Consistently, elevated cytokine mRNA levels and impaired lung functions were improved by B38-CAP treatment. Moreover, in SARS-CoV-2-infected humanized ACE2 transgenic mice, B38-CAP significantly improved the pathologies of lung injury, alleviated the cytokine storms and downregulated viral RNA levels. These results provide the first experimental in vivo evidence that increasing ACE2-like enzymatic activity is a potential and powerful therapeutic strategy for lung pathologies in COVID-19.

Pulmonology

Virology

Biological Chemistry

Drug Discovery, Design, & Development

SARS-CoV-2

Angiotensin-converting enzyme 2

ACE2

angiotensin

COVID-19

lung injury

ARDS

B38-CAP

cytokine

Spike

Severe acute respiratory syndrome coronavirus (SARS coronavirus or SARS-CoV) emerged in 2003 as an epidemic of highly contagious and deadly respiratory disease ^1-3. In December 2019, a new coronavirus, SARS-CoV-2 was first identified in a pneumonia outbreak in Wuhan, China and spread rapidly all over the world in a few months, leading to the current pandemic^4,5. Infection of this virus causes Coronavirus Disease 2019 (COVID-19) with respiratory symptoms ranging from mild disease to severe acute lung injury/acute respiratory distress syndrome (ARDS) and multi-organ failure with high mortality, especially in patients with cardiovascular diseases, diabetes or advanced age ^6-8. Angiotensin-converting enzyme 2 (ACE2) was identified as a receptor for entry of SARS coronavirus into host cells in vitro and in vivo ^9,10. The Spike (S) protein in SARS-CoV-2 shares structural similarities with the Spike in SARS coronavirus, and SARS-CoV-2 is also shown to utilize ACE2 as a receptor for cell entry in vitro ^4,11,12.

ACE2 was originally discovered as the enzyme homologous to angiotensin-converting enzyme (ACE) in 2000 ^13,14. The renin–angiotensin system (RAS) maintains blood pressure and fluid balance ^15,16, while it worsens cardiovascular diseases¹⁷. When the RAS is activated, ACE as a carboxypeptidase cleaves angiotensin I to generate a vasopressor angiotensin II (Ang II). ACE2 is a negative regulator of the RAS, which catalyzes degradation of Ang II to angiotensin 1-7, thereby counterbalancing ACE activity ^13,14. The RAS activation has been shown to worsen the pathologies of ARDS/acute lung injury ¹⁸. ACE2 expression is downregulated in the lungs of mice under acute lung injury induced by various causes including acid aspiration, sepsis and lethal influenza infection ^18-20. Loss of ACE2 augments acute lung injury through Ang II upregulation, whereas treatment with recombinant soluble ACE2, which is devoid of membrane-anchored domain, improves lung injury ¹⁸. ACE2 expression is markedly downregulated in the lungs of SARS coronavirus-infected mice, and injecting Spike protein of the SARS coronavirus into mice down-modulates ACE2 expression, thereby worsening lung injury through RAS activation ^10,18. On the other hand, recent studies on SARS-CoV-2 suggested that mRNA expression of ACE2 was upregulated in certain subsets of cells in SARS-CoV-2 infected lungs ^21,22. Thus, ACE2 expression in the lungs with SARS-CoV-2 infection remains to be investigated.

Treatment with recombinant soluble human ACE2 protein (rshACE2) was demonstrated to exhibit beneficial effects in various disease models including heart failure and diabetic nephropathy as well as acute lung injury ^18,23,24. rshACE2 has been developed as a therapeutic for treating the patients with ARDS/acute lung injury. In addition, rshACE2 was recently shown to bind to SARS-CoV-2 Spike, thereby suppressing the infection of SARS-CoV-2 in human cells or organoids in vitro ²⁵. Thus, rshACE2 functions both as a decoy to inhibit cell entry of SARS-CoV-2 and as an enzyme to protect from lung injury. However, the significance of ACE2 enzymatic activity in COVID-19 remains elusive. We have recently identified a bacteria-derived carboxypeptidase B38-CAP as an ACE2-like enzyme ²⁶. Recombinant B38-CAP protein catalyzes the conversion of Ang II to angiotensin 1-7 as well as hydrolysis of other ACE2 substrate peptides including des-Arg⁹-bradykinin, apelin and dynorphin A, with the same potency as ACE2^Ref. ^26,27. Treatment with B38-CAP downregulates Ang II levels in mice and thereby antagonizes Ang II-induced hypertension and improves heart failure without overt toxicities ²⁶. Thus, B38-CAP is anticipated to suppress acute lung injury.

In this study, we show that expression of ACE2 protein is downregulated in the lungs of SARS-CoV-2-infected hamsters, whereas B38-CAP as an ACE2-like enzyme improves SARS-CoV-2-induced lung injury. Recombinant S1 domain or receptor-binding domain (RBD) of the SARS-CoV-2 Spike protein bound to ACE2 and downregulated ACE2 expression, thereby worsening the symptoms of acid-induced lung injury in hamsters. B38-CAP downregulated Spike RBD-induced Ang II upregulation. B38-CAP suppressed Spike RBD-induced severe inflammation and pulmonary edema and improved worse lung functions and high cytokine mRNA levels. Furthermore, when SARS-CoV-2 was infected to human ACE2 Tg mice, B38-CAP improved the pathologies of lung injury and downregulated mRNA expression of cytokines and viral RNA loads in the lungs.

Downregulation of ACE2 protein expression by SARS-CoV-2 infection and Spike protein.

To determine the effects of SARS-CoV-2 infection on ACE2 protein expression in the lungs (Fig. 1a), we infected hamsters with SARS-CoV-2 (UT-NCGM02 or HKU-001a) through intranasal inoculation　^28,29. At 4 days after infection, while viral Nucleocapsid phosphoprotein (NP) was highly expressed in the lungs, protein expression of ACE2 was significantly downregulated in the lungs of SARS-CoV-2 infected hamsters, and the two different isolates of the virus (UT-NCGM02 and HKU-001a) showed consistent results (Fig. 1b, c; Extended Data Fig. 1a). We reasoned that reduced ACE2 expression might affect the lung pathologies of SARS-CoV-2 infection as seen in the mice infected with SARS coronavirus ¹⁰. To test this, we constructed expression vectors for S1 domain (1-685 amino acids) and receptor-binding domain (RBD) (319-541 amino acids) of SARS-CoV-2 Spike fused to human Fc, described hereafter as S1-Fc and RBD-Fc, respectively (Fig. 1d). We expressed and purified S1-Fc and RBD-Fc proteins in 293 cells (Extended Data Fig. 1b, c). We examined whether recombinant SARS-CoV-2 Spike protein (S1-Fc and RBD-Fc) bind to ACE2 protein using in vitro pull-down assays. Both S1-Fc and RBD-Fc indeed pulled down human and hamster ACE2 (Fig. 1e; Extended Data Fig. 1d, e). Since recombinant Spike or RBD of the SARS coronavirus downregulates ACE2 expression ^10,30, we examined the effects of SARS-CoV-2 Spike protein on ACE2 expression. We treated Vero E6 cells with RBD-Fc and analyzed expression of endogenous ACE2 on the cell surface. RBD-Fc bound to endogenous ACE2 in Vero E6 cells (Extended Data Fig. 1f, g). Decreased binding of RBD-Fc to ACE2 at 37^oC compared with at 4^oC suggested that ACE2 expression on the cell surface was downregulated by RBD-Fc, possibly through internalization or shedding as previously described for SARS coronavirus ^30,31 (Extended Data Fig. 1f, g).

We determined whether S1-Fc or RBD-Fc downregulates ACE2 expression in vivo. When hamsters were treated with S1-Fc, RBD-Fc or control-Fc, immunohistochemistry with anti-human Fc antibody showed that S1-Fc and RBD-Fc but not control-Fc localized in the lungs of hamsters (Fig. 1f). Treatment with S1-Fc or RBD-Fc downregulated expression of ACE2 in the lungs compared with control-Fc treatment (Fig. 1g-i). We next introduced acute lung injury to hamsters with intra-tracheal instillation of acid (0.1 M HCl, 100 ml) and kept them without mechanical ventilation support (Fig. 1g). In the hamsters under acid aspiration-induced lung injury, downregulation of ACE2 expression was augmented by S1-Fc and RBD-Fc (Fig.1h, i). Consistently, plasma Ang II levels were significantly upregulated by S1-Fc or RBD-Fc in hamsters with acute lung injury (Fig. 1j). Thus, SARS-CoV-2 Spike protein (S1-Fc or RBD-Fc) downregulates ACE2 expression and induces RAS activation in vivo.

SARS-CoV-2 Spike protein worsens acute lung injury

In hamsters without acid-instillation, we observed mild swelling of the lungs treated with S1-Fc or RBD-Fc but not control-Fc (Fig. 2a). S1-Fc-treated hamsters showed slight but significant increase of lung edema as defined by wet weight to dry weight ratio of the lungs (Wet/Dry ratio) (Fig. 2b). In addition, S1-Fc-treated lungs exhibited occasional red spots suggestive of focal hemorrhage (Fig. 2a). Histological analysis showed mild pathologies in S1-Fc or RBD-Fc-treated lungs (Fig. 2c, d), suggesting that Spike protein is likely pro-inflammatory in lungs. We next examined the effects of Spike proteins on acid-induced lung injury (Fig. 1h). At 24 hours after acid aspiration the lungs appeared mildly reddish and swollen with occasional hemorrhagic spots in control-Fc protein-treated hamsters (Fig. 2a). When Spike protein S1-Fc or RBD-Fc was intraperitoneally injected in addition to acid instillation, the hamsters exhibited severe lung injury with massive inflammation and hemorrhage (Fig. 2a) and showed significant increase of wet to dry weight ratio of the lungs (Fig. 2b), indicating that S1-Fc or RBD-Fc induced severe lung edema. Consistently, histological analysis showed the pathologies of severe lung inflammation in Spike (S1-Fc or RBD-Fc) plus acid-treated hamsters (Fig. 2c, d). Thus, SARS-CoV-2 Spike protein augments acid-induced lung injury.

B38-CAP suppresses SARS-CoV-2 Spike-induced lung injury.

While recombinant human soluble ACE2 degrades Ang II, it binds to RBD of the Spike thereby inhibiting the entry of SARS-CoV-2 into cells (Fig. 3a). We first examined whether B38-CAP binds to RBD-Fc protein in vitro. While soluble ACE2 was efficiently co-immunoprecipitated with RBD-Fc, B38-CAP was not pulled down with RBD-Fc (Extended Data Fig. 2a, b). Thus, B38-CAP is an ACE2-like enzyme devoid of the ability to inhibit cell entry of SARS-CoV-2. We intraperitoneally injected B38-CAP (2 mg/kg per injection) to the hamsters under acid-induced lung injury with or without Spike (RBD-Fc) treatment (Fig. 3b). At 2 hours after last injection of B38-CAP or vehicle, ACE2 enzymatic activity was markedly elevated in the plasma of B38-CAP-treated hamsters (Fig. 3c). In line with increased ACE2 activity, elevated Ang II levels were significantly downregulated in the plasma of B38-CAP-treated hamsters compared with vehicle-treated ones (Fig. 3d), indicating that injected B38-CAP is functional as an ACE2-like enzyme to degrade Ang II in hamsters. In the hamsters treated with acid and control-Fc, B38-CAP significantly suppressed acid-induced swelling of the lungs and downregulated wet to dry weight ratio of the lungs (Fig. 3e, f). Importantly, in the hamsters under RBD-Fc plus acid-induced lung injury, severe inflammation and pulmonary edema was markedly attenuated by B38-CAP treatment (Fig. 3e, f). Consistently, lung pathologies were significantly improved by B38-CAP (Fig. 3g, h). In addition, lung functions were measured as lung elastance and airway resistance. RBD-Fc-induced impairment of lung functions; increased elastance and resistance were significantly improved by B38-CAP (Fig. 3i, j; Extended Data Fig. 3a, b). It should be noted that treatment with B38-CAP improved serum markers of tissue injury (LDH) and kidney and liver functions (Cr, ALT and AST) but did not show any toxicities on its own (Extended Data Fig. 3c-g). Furthermore, we examined mRNA expression of cytokines (IL-6, TNF-a and CXCL10) which are known to be upregulated in COVID-19 patients. While mRNA expression of IL-6, TNF-a and CXCL10 were also upregulated in RBD-Fc plus acid-treated hamsters, B38-CAP treatment significantly downregulated high cytokine mRNA levels (Fig. 3k-m). Therefore, B38-CAP suppresses Spike RBD-induced severe lung injury.

Effects of B38-CAP on lung injury induced by SARS-CoV-2 infection in hACE2 Tg mice.

To address the effects of B38-CAP in acute lung injury induced by SARS-CoV-2 infection, we utilized human ACE2 transgenic (hACE2 Tg) mice, in which expression of human ACE2 is induced by CAG promoter. Human ACE2 protein was detected in the lungs of hACE2 Tg mice but not wild type mice (Fig. 4a). We inoculated intratracheally with SARS-CoV-2 stock virus (UT-NCGM02) at a dosage of 2 x 10³ TCID₅₀ per mouse. At 12 hours after SARS-CoV-2 infection, we initiated the intraperitoneal injection of B38-CAP (2 mg/kg per injection) every 12 hours to the mice (Fig. 4b). At 4 days after infection, the mice were euthanized and lung tissues were harvested. When virus N RNA levels were measured as readout for viral replication in the lungs, copy numbers of N RNA were significantly downregulated in the lungs of B38-CAP treated mice compared with vehicle-treated mice (Fig. 4c). Histological analysis showed that B38-CAP improved the lung pathologies (Fig. 4d), and lung injury score was significantly decreased in B38-CAP-treated mice compared with vehicle-treated mice (Fig. 4e). Importantly, while mRNA levels of inflammatory cytokines (IL-6, TNF-a, CXCL10, CXCL2 and IFN-g) were upregulated by SARS-CoV-2 infection, those cytokine mRNA levels were significantly downregulated in B38-CAP-treated mice compared to vehicle-treated mice (Fig. 4f-j). Thus, B38-CAP has the ability to suppress inflammation and pathologies in the lungs of hACE2 Tg mice with COVID-19.

In this study, we demonstrated that SARS-CoV-2 infection and Spike protein treatment downregulate ACE2 expression in vivo and that B38-CAP as an ACE2-like enzyme but not a decoy for the virus suppresses SARS-CoV-2 Spike RBD protein-induced lung injury associated with decreased Ang II levels. We further showed that B38-CAP improves lung injury induced by SARS-CoV-2 infection in hACE2 Tg mice.

Previous studies on SARS coronavirus had shown that internalization or shedding of cell-surface ACE2 upon entry of SARS coronavirus into cells and NF-kB-induced microRNA-mediated downregulation of ACE2 mRNA expression in infected cells are the mechanisms of ACE2 downregulation ^31-33. Indeed, SARS-CoV-2 Spike protein (RBD-Fc) partly reduced cell-surface ACE2 expression in in vitro cell culture (Extended Data Fig. 1f, g). In addition, transcriptional downregulation of ACE2 by ZEB1 in SARS-CoV-2 infection was recently reported ³⁴. Thus, there seem various mechanisms for ACE2 downregulation by SARS-CoV-2 infection. On the other hand, despite clear evidence of ACE2 downregulation in the infected lungs, recent studies showed that interferon signaling upregulates ACE2 mRNA expression, implicating that SARS-CoV-2-infected cells increase ACE2 expression in their neighboring cells through interferon signaling and thus augments viral infection in local tissue microenvironment ²¹. However, such upregulation of ACE2 in interferon-activated cells might be temporal, because viral infection would lead to downregulation of ACE2 expression. Thus, both induction of local ACE2 mRNA expression enhancing viral infectivity and downregulation of bulk ACE2 protein promoting lung pathologies need to be further investigated.

Soluble ACE2 has a two-pronged approach for treating COVID-19; a carboxypeptidase to suppress lung injury and a decoy to neutralize SARS-CoV-2 infection. Since B38-CAP did not bind to RBD of the Spike but mitigated RBD-Fc-induced lung injury in hamsters, the ACE2-like enzymatic activity of B38-CAP is crucial for its therapeutic effects on lung injury of COVID-19. Reduction of viral loads in hACE2 Tg mice by B38-CAP is also likely to be exerted through its ACE2-like enzymatic activity, because soluble ACE2 suppresses replication of H5N1 or H7N9 influenza virus in vivo without directly inhibiting virus entry ^19,20. Accordingly, it would be speculated that therapeutics to suppress the RAS, such as angiotensin-receptor blocker (ARB) and ACE inhibitor, might be also beneficial for COVID-19 patients. In fact, although initial epidemiological studies showed that medication of ARB or ACE inhibitor did not affect infectivity of SARS-CoV-2 and severity of COVID-19 in the patients ^35-37, recent meta-analysis suggested that those inhibitors might be associated with better prognosis of the patients ^37,38. It should be noted that the enzymatic activity of both B38-CAP and ACE2 does not only degrade Ang II but also generates angiotensin 1-7, which is protective against lung injury through activation of the Mas receptor ³⁹. In addition, both ACE2 and B38-CAP target other peptide for its substrates. For instance, des-Arg⁹-bradykinin is an agonist of B1 bradykinin receptor, and activation of the B1 receptor promotes lung injury, while ACE2 and B38-CAP degrade des-Arg⁹-bradykinin ^40,41. Therefore, the beneficial effect of ACE2 enzymatic activity in SARS-CoV-2-induced lung injury include the effects of generated metabolites and degradation of other pro-inflammatory peptides as well as downregulation of Ang II.

Although soluble ACE2 functional as both lung-protecting enzyme and decoy for the virus would be ideal for COVID-19 treatment, the efficacy of its decoy function in in vivo infection remains elusive. Given that ACE2 enzymatic activity is effective in treating lung injury of COVID-19, B38-CAP might be an alternate option to increase ACE2 activity in the lungs. For instance, development of B38-CAP as an inhalation drug might be advantageous, considering its cost-effective production and bacterial origin. Most of the drugs currently available for COVID-19 are re-positioned from other diseases or not specifically targeted for COVID-19. Our data show that ACE2 enzymatic activity is a potential therapeutic strategy to alleviate the symptoms of acute lung pathologies in COVID-19, further warranting the significance of specific molecular targeting in treating COVID-19.

Viruses

SARS-CoV-2 (Tokyo strain, UT-NCGM02) was maintained as previously described ²⁹ and used in the experimental infection of hamsters and hACE2 Tg mice at the University of Tokyo and at the Tsukuba Primate Research Center of National Institute of Biomedical Innovation, Health and Nutrition (NIBIOHN), respectively. SARS-CoV-2 (Hong Kong strain, HKU-001a (GenBank: MT230904.1)) was maintained as previously described ²⁸ and also used in the infection experiment of hamsters at the University of Hong Kong. All experiments with live SARS-CoV-2 were performed in enhanced biosafety level 3 (BSL3) containment laboratories at Tsukuba Primate Research Center of the NIBIOHN, at the University of Tokyo or at the University of Hong Kong, which followed the approved standard operating procedures of BSL3 facility as previously described ^28,29.

Animals

Three and ten week-old male Syrian hamsters were purchased from SLC Japan and maintained at the animal facilities of Akita University or University of Tokyo. Female Syrian hamsters, aged 6 weeks old, were obtained from the Chinese University of Hong Kong Laboratory Animal Service through the Centre Center for Comparative Medicine Research of the University of Hong Kong. Human ACE2 transgenic (hACE2 Tg) mice, which express human ACE2 in the whole body under CAG promoter, were generated and donated by Drs. Akihiko Uda and Kiyoshi Tanabayashi at National Institute of Infectious Diseases. Human ACE2 cDNA was cloned into pCAGGSP7 vector, and fonder mice were generated with pronuclear injection of the expression cassette into zygotes and crossed to C57BL/6J mice. All three lines of the mice (#5, #16, #17) were infective of SARS coronavirus (Uda A, Tanabayashi K, et al. manuscript in preparation). The mice had been cryo-archived and were recovered at Laboratory Animal Resource Bank of NIBIOHN (https://animal.nibiohn.go.jp/e_ace2_tg_17.html). The recovered line #17 was efficient in expanding colonies and used in this study, and expression of human ACE2 was confirmed with Western blot, and the genotypes of mice were determined by PCR for tail DNA with the primer pair; 5’- CTTGGTGATATGTGGGGTAGA -3’ and 5’- CGCTTCATCTCCCACCACTT -3’. hACE2 Tg mice were maintained as heterozygous (hACE2^Tg/+) by crossing hACE2^Tg/+mice with wild type mice at the animal facility of NIBIOHN. All animal experiments conformed to the Guide for the Care and Use of Laboratory Animals, Eighth Edition, updated by the US National Research Council Committee in 2011, and approvals of the experiments were granted by the ethics review board of Akita University, NIBIOHN, the University of Tokyo or the University of Hong Kong.

Experimental infection of hamsters.

To measure ACE2 protein expression in the infected lungs, experimental infection of hamsters was conducted in enhanced BSL3 laboratory at the University of Tokyo and at the University of Hong Kong. Ten week-old male Syrian hamsters (Japan SLC, Inc.) and 6 week-old female Syrian hamsters (originally from Envigo) were used at the University of Tokyo and at the University of Hong Kong, respectively ^28,29. Under ketamine-xylazine anesthesia, six of 10 week-old male hamsters and five of 6 week-old female hamsters were inoculated via intranasal routes with 10³ PFU (in 100 μL PBS) of the SARS-CoV-2 (Tokyo strain, UT-NCGM02) and 10⁵ PFU (in 100 μL PBS) of the virus (Hong Kong strain, HKU-001a), respectively. At four days after infection, hamsters were euthanized with overdose of anesthesia, lung tissues were harvested for preparation of protein lysates and live virus inactivated with heat (92^oC, 15 min) and detergent (2% SDS).

Experimental infection of hACE2 Tg mice.

To investigate the effects of B38-CAP in SARS-CoV-2 infection, experimental infection of hACE2 Tg mice was conducted in enhanced BSL3 laboratory at Tsukuba Primate Research Center of the NIBIOHN. Seven 3-month-old male hACE2 Tg mice were inoculated with 2 x 10³ TCID₅₀ (in 25 μl PBS) of the SARS-CoV-2 (UT-NCGM02) via the intratracheal route under anesthesia with cocktails of 0.2 mg/kg medetomidine, 6 mg/kg midazolam and 10 mg/kg butorphanol tartrate. At 12 hours after infection, the mice were divided into two groups, intraperitoneal injection of B38-CAP (2 mg/kg per i.p.) (n = 4) or vehicle (n = 3) was initiated and repeated every 12 hours. At four days after infection, mice were euthanized with overdose of anesthesia, left and right lungs were harvested with 4% formalin fixation for histological examination and TRIzol reagent (Invitrogen) to measure RNA expression, respectively.

Recombinant proteins

The coding sequence of S1 domain (1-685 amino acids) or RBD (319-541 amino acids) of the Spike protein of SARS-CoV-2 were codon optimized, synthesized, and subcloned into the pCAGGS vector to generate a fusion protein with the Fc portion of human IgG1. Human Expi293F cells (Gibco) were transfected with the S1-Fc and RBD-Fc expression vector, supernatants harvested, and S1-Fc and RBD-Fc protein purified by affinity chromatography using a Protein A HP column (Cytiva). Control-Fc protein (#AG714; Merck) was purchased. Recombinant B38-CAP protein was expressed in E. coli. and purified as previously described²⁶. All the proteins were confirmed free of endotoxin contamination (<0.1 EU/µg protein) with LAL Endotoxin Assay Kit (Genscript).

In vitro binding assays

For pull-down assay to evaluate binding of Spike proteins (S1-Fc and RBD-Fc) to human ACE2 or hamster ACE2 protein, Caco2 human colon epithelial cells or hamster lung tissues were homogenized in lysis buffer (50 mM Tris-HCl, pH 7.4, 20 mM EDTA, and 1% triton-X100) supplemented with protease inhibitor cocktails. Protein lysates were incubated with S1-Fc, RBD-Fc or control human IgG-Fc protein with gentle agitation for 2 hours at 4℃. S1-Fc, RBD-Fc or control-Fc protein were pulled down by Protein G dynabeads (Thermo Fisher Scientific), proteins separated by SDS-PAGE and transferred to a Nitrocellulose membrane. The membranes were probed with anti-human ACE2 antibody (R&D systems, MAB9331), anti-mouse ACE2 antibody⁴² for detection of hamster ACE2 or anti-human IgG antibody (MBL, 103R). For assessment of binding of B38-CAP to RBD-Fc, B38-CAP was detected by B38-CAP-specific polyclonal antibody as previously described ²⁶, and recombinant soluble human ACE2 (R&D systems, 933-ZN) was served as a positive control for binding to RBD-Fc. Flow cytometry analysis to address the effects of RBD-Fc on cell-surface ACE2 expression was done as previously described ^10,30. Briefly, Vero E6 cells are detached by 2 mM EDTA/PBS and incubated with RBD-Fc or control-Fc protein at 4℃ or 37℃ for 3 hours. Cells were then incubated with FITC-conjugated human IgG-specific polyclonal antibody (Jackson ImmunoResearch, #109-095-088) for detection of RBD-Fc protein and control-Fc bound to Vero E6 cells, and samples were analyzed by flow cytometry using a FACS Calibur (Becton Dickinson).

Spike protein-mediated acute lung injury in hamsters

For acid aspiration-induced acute lung injury, three week-old male hamsters were anesthetized with ketamine (200 mg/kg) and xylazine (10 mg/kg), and were intratracheally instilled with 0.1 M HCl (in 100 μl PBS). For spike plus acid aspiration-induced lung injury, SARS-CoV-2 Spike proteins (S1-Fc or RBD-Fc) or control-Fc (11 nmol/kg per i.p. injection) were intraperitoneally injected 30 minutes before and at 12 hours after acid aspiration. For B38-CAP treatment, B38-CAP protein (2 mg/kg) or vehicle was i.p. injected at 3 and 15 hours after acid instillation. To evaluate lung pathologies, the hamsters were euthanized with overdose of anesthesia at 24 hours after acid instillation, and blood samples were collected with protease-inhibitor cocktails for Ang II measurements and lungs were excised en bloc with hearts. After taking macro photography of the lungs, the left lobe of lungs, which usually exhibit more severe injury than right lungs, was cut into three pieces to measure wet to dry weight ratio, RNA expression and protein expression, and the posterior lobe of right lungs was fixed with 4% formalin samples for histological analysis. For measurements of lung function, the hamsters were anesthetized with ketamine and xylazine at 17 hours after acid aspiration, tracheostomized, mechanically ventilated and lung function measured with Resistance and Compliance system (Buxco). Pulmonary function parameters; elastance, resistance and dynamic or static compliance were obtained under mechanical ventilation with tidal volume (10 ml/kg) and PEEP (2 cm H₂O) for 15 minutes. After measurements, the hamsters were euthanized with overdose of anesthesia, and heparinized blood samples were collected for measuring ACE2 enzymatic activity.

Histopathology and immunohistochemistry

Lung tissues were fixed with 4% formalin and embedded in paraffin. Five mm thick sections were prepared and stained with Hematoxylin & Eosin (H&E). For semi quantitative assessment of lung injury, the high-resolution images (x200 magnification) of the lung sections stained with H&E were taken with microscope (Nikon). Three randomly chosen fields of each section were scored for Lung injury score in a blinded fashion using a previously defined score consisting of alveolar congestion, hemorrhage, neutrophil infiltration, thickness of alveolar wall, and hyaline membrane formation, as follows: 0 = minimal (little) damage, 1 = mild damage, 2 = moderate damage, 3= severe damage and 4 = maximal damage ¹⁰. The average Lung injury score of three fields of each section were used as the one individual Lung injury score. For immunohistochemistry of S1-Fc or RBD-Fc proteins in the lungs, 5 mm sections were pretreated with EDTA buffer at 72℃ and stained with peroxidase-conjugated anti-human Fc antibody (Jackson ImmunoResearch, # 109-035-098).

Western blotting

Lung proteins were extracted with TNE lysis buffer (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% NP40, protease inhibitor (Complete Mini; Roche) using Microsmash (MS-100R; TOMY), 20 mM NaF, 2 mM Na₃VO₄), were sonicated and denatured with LDS sample buffer (Invitrogen) at 70°C. For protein extraction from SARS-CoV-2-infected lungs in BSL3 laboratory, 20 mg pieces of the lung tissues were homogenized by using 3-min Total Protein Extraction Kit (P502L; 101Bio), and the lysates were denatured with 1.3x LDS sample buffer (Invitrogen) or 2% SDS at 92°C for 15 minutes. After confirming virus inactivation, the protein samples were taken out from BSL3 laboratory. Proteins were electrophoresed on NuPAGE bis-tris precast gels (Invitrogen) and transferred to nitrocellulose membranes (Invitrogen). Membranes were probed with following antibodies; anti-mouse ACE2 antibody for detection of hamster ACE2^Ref. ⁴², anti-hamster GAPDH antibody (GeneTex, GTX100118), anti-SARS-CoV/SARS-CoV-2 NP antibody²⁸, anti-human ACE2 antibody (R&D systems, MAB9331), anti-b-actin antibody (Sigma, A5316) or anti-human IgG antibody (MBL, 103R). The blotting bands visualized with ECL reagent (Bio-Rad) using ChemiDoc Touch Imaging System (Bio-Rad). Image Lab software was used to quantify band intensity.

Measurements of cytokine mRNA expression by qRT-PCR

qRT-PCR analysis was conducted as previously described ²⁶. Briefly, total RNA was extracted using TRIzol reagent (Invitrogen) and cDNA synthesized using the PrimeScript RT reagent kit (RR037; TAKARA). Quantitative real-time PCR was run in 96 well plates using a SYBR Premix ExTaq II (RR820; TAKARA) according to the instructions of the manufacturer. Relative gene expression levels were quantified by using the Thermal Cycler Dice Real Time System II software (TAKARA). Sequences of the forward and reverse primers of the genes studied are shown in Extended Data Table 1.

Viral load determination by qRT-PCR

qRT-PCR to quantify viral N gene copies was conducted in 2 steps; reverse transcriptase (RT) reaction and real-time probe qPCR, with modifications of the diagnostic protocol released from National Institute of Infectious Disease in Tokyo, Japan ⁴³. The primer and probe sequences are: 5’-AAATTTTGGGGACCAGGAAC-3’ (forward primer (NIID_2019-nCOV_N_F2)), 5’-TGGCAGCTGTGTAGGTCAAC-3’ (reverse primer (NIID_2019-nCOV_N_R2)) and 5’-FAM-ATGTCGCGCATTGGCATGGA-BHQ-3’ (probe (NIID_2019-nCOV_N_P2)). cDNA was synthesized using the PrimeScript RT reagent kit (RR037; TAKARA) in 10 ml RT reaction containing 2 ml 5x PrimeScript Buffer, 0.5 ml PrimeScript RT Enzyme Mix, 10 ng/ml total RNA and 10 mM viral N gene-specific primer (NIID_2019-nCOV_N_R2) with the condition of RT at 42°C for 15 min and inactivation of reverse transcriptase at 85°C for 5 s. The RT reaction products were 10-fold diluted, and one ml of the diluents were subjected to quantitative real-time PCR using Probe qPCR kit (RR390A; TAKARA) in 25 ml qPCR reaction containing 12.5 ml 2x Premix Ex Taq and 5 ml 5x NIID_2019-nCOV_N_ Primer/Probe mix (XD0007; TAKARA) with 40 cycles of PCR amplification (Denaturing at 95°C for 5 s; Annealing/Extending at 60°C for 30 s). The expected amplicon size is 158 bp. The standard curve of qRT-PCR was generated by RT reaction with serial 10-fold dilutions of synthesized N RNA fragment (XA0142; TAKARA) with a known copy number (from 1.0 x 10⁶ to 1.0 × 10² copies per μl of RT reaction) in the presence of 10 ng/ml total RNA from uninfected mouse lungs, followed by the real-time probe qPCR with one μl of the 10-fold-diluted RT reaction products. These dilutions were used as quantification standards to construct the standard curve by plotting the RNA copy number against the corresponding threshold cycle values (Ct). Results were expressed as log10-transformed numbers of viral N RNA copy numbers per gram of the lung tissues.

Measurements of Ang II levels and ACE2 activity in hamster plasma

Plasma Ang II levels were measured with ELISA assay after peptide extraction as previously described ²⁶. Briefly, blood samples were collected in tubes containing EDTA (25 mM), o-phenanthroline (0.44 mM), pepstatin A (0.12 mM), and p-hydroxymercuribenzoic acid (1 mM), and then centrifuged at 1,200 x g for 10 min. Angiotensin peptides were acidified and extracted with Sep-Pak cartridges (Waters), and Ang II in the peptide extract was quantified using an ELISA kit (Enzo Life Sciences). Plasma ACE2 activity was measured as previously described ²⁶. Heparinized plasma was diluted with assay buffer, and the reaction mixture contained 45 μl of HEPES buffer, pH 7.5, 0.3 M NaCl, 20 μM Nma-Leu-Pro-Lys(Dnp), 0.01% Triton X-100, 0.02% NaN₃, and 5 μl diluted plasma or recombinant B38-CAP in a total volume of 50 μl. The reaction mixture was incubated at 37 ^oC for 60 min and then the reaction was terminated by adding 0.2 ml of 0.1 M sodium borate buffer pH 10.5, and the fluorescence intensity was measured. Plasma ACE2 activity was calculated based on the standard recombinant B38-CAP activity.

Measurements of markers for tissue injury and liver and kidney functions

Plasma levels of Lactate dehydrogenase (LDH), Aspartate transaminase (AST) or Alanine transaminase (ALT), Creatinine (Cr) and Blood Urea Nitrogen (BUN) were measured as markers of liver and kidney damages, respectively, by using FUJI DRI-CHEM slide kits (Fujifilm corporation).

Statistical analyses. Data are presented as mean values ± SEM. Statistical significance between two experimental groups was determined using Student’s two-tailed t-test. Comparisons of parameters among more than 3 groups were analyzed by one-way ANOVA, followed by Sidak’s multiple comparisons test. When a comparison is done for groups with two factor levels, two-way ANOVA with Sidak’s multiple comparisons test were used. P < 0.05 was considered significant.

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request. Source data used to generate Figs. 1-4 and Extended Data Figs. 1, 3 are provided in the Source Data file.

Funding

K.K. is supported by the Kaken [20H03426, 20K21566] from Japanese Ministry of Science and the FY2020 Program to Develop Countermeasure Technologies against Viral and Other Infectious Diseases [24-136] from Japan Agency for Medical research and Development (AMED). Y.I. is supported by the Kaken [17H06179], T.Y. is supported by the Kaken [20K07285] from Japanese Ministry of Science, J.A. is supported by the Kaken [20K16153] from Japanese Ministry of Science, and J.F.-W.C. is supported by Lo Ying Shek Chi Wai Foundation and the National Program on Key Research Project of China [2020YFA0707500 and 2020YFA0707504].

Acknowledgments

We thank all members of our laboratories for technical assistance and helpful discussions. We thank Dr. Kiyoshi Tanabayashi at National Institute of Infectious Diseases for providing hACE2 Tg mice.

Author Contributions

T.M., Y.I. and K.K. conceived the study. T.M., M.H., T.Y., J.A., S.T., S.M., J.M.P., Y.I. and K.K. conducted experiments and/or analyzed data. M.N., S.Nirasawa, S.Nagata. and H.K. prepared recombinant proteins. M.N.A., J.F.-W.C., M.I., D.U., V.K.P., A.Y., C.C.-S.Y., K.-Y.Y., Y.K. and Y.Y. conducted infection experiments. K.K. wrote the manuscript with input from all authors.

Competing Interests

The authors declare no competing interests.

1 Drosten, C. et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med 348, 1967-1976, doi:10.1056/NEJMoa030747 (2003).

2 Lee, N. et al. A major outbreak of severe acute respiratory syndrome in Hong Kong. N Engl J Med 348, 1986-1994, doi:10.1056/NEJMoa030685 (2003).

3 Peiris, J. S. et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361, 1319-1325, doi:10.1016/s0140-6736(03)13077-2 (2003).

4 Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270-273, doi:10.1038/s41586-020-2012-7 (2020).

5 Zhu, N. et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med 382, 727-733, doi:10.1056/NEJMoa2001017 (2020).

6 Zhou, F. et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet 395, 1054-1062, doi:10.1016/S0140-6736(20)30566-3 (2020).

7 Guan, W. J. et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N Engl J Med 382, 1708-1720, doi:10.1056/NEJMoa2002032 (2020).

8 Chan, J. F. et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster. Lancet 395, 514-523, doi:10.1016/S0140-6736(20)30154-9 (2020).

9 Li, W. et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426, 450-454, doi:10.1038/nature02145 (2003).

10 Kuba, K. et al. A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury. Nat Med 11, 875-879, doi:10.1038/nm1267 (2005).

11 Shang, J. et al. Structural basis of receptor recognition by SARS-CoV-2. Nature 581, 221-224, doi:10.1038/s41586-020-2179-y (2020).

12 Wrapp, D. et al. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 367, 1260-1263, doi:10.1126/science.abb2507 (2020).

13 Donoghue, M. et al. A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circ Res 87, E1-9, doi:10.1161/01.res.87.5.e1 (2000).

14 Tipnis, S. R. et al. A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem 275, 33238-33243, doi:10.1074/jbc.M002615200 (2000).

15 Corvol, P., Jeunemaitre, X., Charru, A., Kotelevtsev, Y. & Soubrier, F. Role of the renin-angiotensin system in blood pressure regulation and in human hypertension: new insights from molecular genetics. Recent Prog Horm Res 50, 287-308, doi:10.1016/b978-0-12-571150-0.50017-2 (1995).

16 Skeggs, L. T., Dorer, F. E., Levine, M., Lentz, K. E. & Kahn, J. R. The biochemistry of the renin-angiotensin system. Adv Exp Med Biol 130, 1-27 (1980).

17 Gheblawi, M. et al. Angiotensin-Converting Enzyme 2: SARS-CoV-2 Receptor and Regulator of the Renin-Angiotensin System: Celebrating the 20th Anniversary of the Discovery of ACE2. Circ Res 126, 1456-1474, doi:10.1161/CIRCRESAHA.120.317015 (2020).

18 Imai, Y. et al. Angiotensin-converting enzyme 2 protects from severe acute lung failure. Nature 436, 112-116, doi:10.1038/nature03712 (2005).

19 Yang, P. et al. Angiotensin-converting enzyme 2 (ACE2) mediates influenza H7N9 virus-induced acute lung injury. Sci Rep 4, 7027, doi:10.1038/srep07027 (2014).

20 Zou, Z. et al. Angiotensin-converting enzyme 2 protects from lethal avian influenza A H5N1 infections. Nat Commun 5, 3594, doi:10.1038/ncomms4594 (2014).

21 Ziegler, C. G. K. et al. SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell 181, 1016-1035 e1019, doi:10.1016/j.cell.2020.04.035 (2020).

22 Chua, R. L. et al. COVID-19 severity correlates with airway epithelium-immune cell interactions identified by single-cell analysis. Nat Biotechnol 38, 970-979, doi:10.1038/s41587-020-0602-4 (2020).

23 Oudit, G. Y. et al. Human recombinant ACE2 reduces the progression of diabetic nephropathy. Diabetes 59, 529-538, doi:10.2337/db09-1218 (2010).

24 Zhong, J. et al. Angiotensin-converting enzyme 2 suppresses pathological hypertrophy, myocardial fibrosis, and cardiac dysfunction. Circulation 122, 717-728, 718 p following 728, doi:10.1161/CIRCULATIONAHA.110.955369 (2010).

25 Monteil, V. et al. Inhibition of SARS-CoV-2 Infections in Engineered Human Tissues Using Clinical-Grade Soluble Human ACE2. Cell 181, 905-913 e907, doi:10.1016/j.cell.2020.04.004 (2020).

26 Minato, T. et al. B38-CAP is a bacteria-derived ACE2-like enzyme that suppresses hypertension and cardiac dysfunction. Nat Commun 11, 1058, doi:10.1038/s41467-020-14867-z (2020).

27 Vickers, C. et al. Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem 277, 14838-14843, doi:10.1074/jbc.M200581200 (2002).

28 Chan, J. F. et al. Simulation of the clinical and pathological manifestations of Coronavirus Disease 2019 (COVID-19) in golden Syrian hamster model: implications for disease pathogenesis and transmissibility. Clin Infect Dis, doi:10.1093/cid/ciaa325 (2020).

29 Imai, M. et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc Natl Acad Sci U S A 117, 16587-16595, doi:10.1073/pnas.2009799117 (2020).

30 Wang, S. et al. Endocytosis of the receptor-binding domain of SARS-CoV spike protein together with virus receptor ACE2. Virus Res 136, 8-15, doi:10.1016/j.virusres.2008.03.004 (2008).

31 Haga, S. et al. Modulation of TNF-alpha-converting enzyme by the spike protein of SARS-CoV and ACE2 induces TNF-alpha production and facilitates viral entry. Proc Natl Acad Sci U S A 105, 7809-7814, doi:10.1073/pnas.0711241105 (2008).

32 Lambert, D. W. et al. Tumor necrosis factor-alpha convertase (ADAM17) mediates regulated ectodomain shedding of the severe-acute respiratory syndrome-coronavirus (SARS-CoV) receptor, angiotensin-converting enzyme-2 (ACE2). J Biol Chem 280, 30113-30119, doi:10.1074/jbc.M505111200 (2005).

33 Liu, Q. et al. miRNA-200c-3p is crucial in acute respiratory distress syndrome. Cell Discov 3, 17021, doi:10.1038/celldisc.2017.21 (2017).

34 Stewart, C. A. et al. SARS-CoV-2 infection induces EMT-like molecular changes, including ZEB1-mediated repression of the viral receptor ACE2, in lung cancer models. bioRxiv, doi:10.1101/2020.05.28.122291 (2020).

35 Mancia, G., Rea, F., Ludergnani, M., Apolone, G. & Corrao, G. Renin-Angiotensin-Aldosterone System Blockers and the Risk of Covid-19. N Engl J Med 382, 2431-2440, doi:10.1056/NEJMoa2006923 (2020).

36 Reynolds, H. R. et al. Renin-Angiotensin-Aldosterone System Inhibitors and Risk of Covid-19. N Engl J Med 382, 2441-2448, doi:10.1056/NEJMoa2008975 (2020).

37 de Abajo, F. J. et al. Use of renin-angiotensin-aldosterone system inhibitors and risk of COVID-19 requiring admission to hospital: a case-population study. Lancet 395, 1705-1714, doi:10.1016/S0140-6736(20)31030-8 (2020).

38 Liu, X. et al. Association of angiotensin converting enzyme inhibitors and angiotensin II receptor blockers with risk of COVID-19, inflammation level, severity, and death in patients with COVID-19: A rapid systematic review and meta-analysis. Clin Cardiol, doi:10.1002/clc.23421 (2020).

39 Klein, N. et al. Angiotensin-(1-7) protects from experimental acute lung injury. Crit Care Med 41, e334-343, doi:10.1097/CCM.0b013e31828a6688 (2013).

40 Nasseri, S. et al. Kinin B1 Receptor Antagonist BI113823 Reduces Acute Lung Injury. Crit Care Med 43, e499-507, doi:10.1097/CCM.0000000000001268 (2015).

41 Sodhi, C. P. et al. Attenuation of pulmonary ACE2 activity impairs inactivation of des-Arg(9) bradykinin/BKB1R axis and facilitates LPS-induced neutrophil infiltration. Am J Physiol Lung Cell Mol Physiol 314, L17-L31, doi:10.1152/ajplung.00498.2016 (2018).

42 Crackower, M. A. et al. Angiotensin-converting enzyme 2 is an essential regulator of heart function. Nature 417, 822-828, doi:10.1038/nature00786 (2002).

43 Shirato, K. et al. Development of Genetic Diagnostic Methods for Detection for Novel Coronavirus 2019(nCoV-2019) in Japan. Jpn J Infect Dis 73, 304-307, doi:10.7883/yoken.JJID.2020.061 (2020).

SupplementaryInformation.docx

Download PDF

Journal Publication

published 23 Nov, 2021

Read the published version in Nature Communications →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

ACE2-like carboxypeptidase B38-CAP protects from SARS-CoV-2-induced lung injury

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1