Genotyping of msp1 and msp2
Parasite DNA was extracted from 151 RDTs that yielded positive bands for P. falciparum. All 151 samples were successfully genotyped: 25 from Moroni, 49 from Mitsamiouli, and 77 from Mbeni. Among them, 21 individual alleles were found, including 12 alleles for msp1 gene and 9 alleles for msp2 gene.
For msp1, 7 K1 type alleles (150–300 bp), 3 MAD20 type alleles (190–230 bp), and 2 RO33 type alleles (150 and 200 bp) were observed (Figure 2). The most frequent K1, RO33, MAD20 type alleles were 200 bp (60/132), 150 bp (17/18), and 200 bp (34/64) fragments, respectively. For msp2, 3 FC27 type alleles (350–450 bp) and 6 IC3D7 type alleles (450–700 bp) were obtained. For FC27, the most frequent type allele was 400bp fragments, and the most frequent type allele for IC3D7 was 500 bp fragments (Figure 3).
In all three regions, the K1 family was predominant (55%) for msp1 gene (Table 1). It was more frequent in Mbeni (71.1%) compared to Moroni (50%; p = 0.047) and Mitsamiouli (30.6%; p < 0.01) (Figure 4). There was no significant difference of K1 frequency between Moroni and Mitsamiouli (p > 0.05). However, MAD20 msp1 allelic family was more frequent in Mitsamiouli (22.4%) compared to Moroni (19.2%; p = 0.55) and Mbeni (9.6%; p = 0.02). RO33 msp1 allelic family was poorly represented (2.4–4.0%) in all three sites.
For msp2 gene, IC3D7 allelic family was predominant in Moroni (65%). Furthermore, the frequency was lower in both Mitsamiouli (39%; p = 0.056) and Mbeni (31.6%; p = 0.0012). The FC27 family was found to be dominant in Mbeni (60.5%), in comparison to Moroni (20%; p = 0.0012) and Mitsamiouli (36%; p = 0.013).
In Moroni a total of 10 (40%) samples showed polyclonal infection with at least two clones, resulting in mean multiplicity of infection (MOI) of 1.40 (Table 2). In Mitsamiouli, 26 (53%) samples showed polyclonal infections with at least two clones, (MOI=1.57) and in Mbeni 26 (33.8%) samples were polyclonal (MOI=1.35). No significant difference of MOI between Moroni and Mitsamiouli (p = 0.21) using a non-parametric test. In Mbeni, 26 (33.8%) samples were polyclonal, and mean MOI was 1.35. The difference of MOI was significant between Mbéni and Mitsamiouli (p = 0.02) but no significant difference between Moroni and Mbeni (p = 0.6).
Genotyping of SNPs
In this study, 50 out of 151 (33%) samples were genotyped for 24 SNP markers. Among these, 42 samples (1 from Moroni, 17 from Mitsamiouli, and 24 from Mbeni) and 21 SNPs yielded interpretable results (Additional file 1: Table S1). Altogether, 36 (85%) different genotypes were obtained. Six (15%) isolates grouped into two clusters, defined as a group of parasites with identical nucleotide sequences: one cluster consisting of 2 (5%) parasite populations from Mitsamiouli (defined by the barcode TACCXCGACXTAATAAGAXGG) and another cluster consisting of 4 (10%) samples from Mbeni (defined by the barcode TATTCCGTTGCCACTCGATTG). The X symbol indicates that there is no amplification. Moreover, among 36 genetically unique parasites, several isolates had a strong linkage since they only differed from each other by a few nucleotides (Additional file 2: Figure S1).
Allelic frequency
Data on allelic frequency showed that several nucleotides predominated at the study sites. At P2 position, adenine (A) predominated in all sites. At P5 position, cytosine (C) predominated. At positions P21 and P24, adenine (A) and guanine (G) were seen in the majority of isolates collected in Mitsamiouli and Moroni, respectively. The lowest of minority alleles frequency (MAF) was found in position 20 with 11.9% (Additional file: Table S1).
Comparison of clonality between SNPs and msp
To investigate if there is an association between barcode and msp (clonality), SNPs (clusters and unique barcodes) were classified as monoclonal or polyclonal. Analysis showed that all clusters were polyclonal. Among unique barcodes, 7 (24.1%) were monoclonal, and 29 (75.9%) were polyclonal.
Genetic diversity
Genetic diversity (He) was estimated from msp and SNPs. For msp genes, the highest mean diversity was observed for Moroni ( He= 0.84) and Mbeni (He = 0.83) table 3. There was no significant difference between Mbeni and other sites (each p = 0.99). The mean genetic diversity for all sites was 0.83 (table 3). For SNPs, He was determined at Mitsamiouli and Mbeni. The highest genetic diversity was found at Mitsamiouli (He = 1) and the lowest at Mbeni (He = 0.41).
Otherwise, He values were compared using both methods (SNPs, Msp) in both sites. The msp gene had He values higher in Mbeni (the difference was significant, p <0.01) and in both sites but no significant difference (p = 0.53). However, in Mitsamiouli, SNPs had higher He but no significant difference (p = 0.8) (Table 4).