Molecular Characterization of a Natural Mutant of Feline Calicivirus in China

doi:10.21203/rs.3.rs-863462/v1

Download PDF

Short Report

Molecular Characterization of a Natural Mutant of Feline Calicivirus in China

https://doi.org/10.21203/rs.3.rs-863462/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

During epidemiological surveillance of Feline calicivirus (FCV) isolates in Shanghai, China, a natural mutant of FCV, designated SH1909, was successfully isolated from a stray cat. The complete genome sequence of SH1909 was determined in this study. Sequence comparison and analysis showed that thirteen unique aa residues substitutions and single-aa insertion of N or Y were observed in SH1909, which indicated that SH1909 was a novel and natural mutant of FCV. Interestingly, phylogenetic analysis based on LC-VP1 showed SH1909 could be clustered into an independent evolutionary branch with some Chinese isolates and was more distantly related to vaccine strains, indicating its potential to escape from vaccine-elicited immunity. According to the predicted B-cell epitopes of LC-VP1, amino acid mutation sites and positive selective sites, peptide C (aa sites: 445–460) and, peptide D (aa sites: 425–440) located in the hypervariable regions of LC-VP1, may result in the decreased immunological protection. Moreover, amino acid sites 439 and 449 may be responsible for the potential immune escape of SH1909. This study provides an important insight into genetic variations of FCV and vaccine development.

Internal Medicine

Veterinary Epidemiology

FCV

Mutated

Chinese isolates

Immune escape

The Calicivirus family currently consists of eleven genera: Bavovirus, Lagovirus, Minovirus, Nacovirus, Nebovirus, Norovirus, Recovirus, Salovirus, Sapovirus, Valovirus, and Vesivirus (https:// www.caliciviridae.com/index.html). Feline calicivirus (FCV) is a member of the genus Vesivirus in the family Caliciviridae (Green et al. 2000). Its genome is a single-stranded, positive-sense RNA molecule with a length of about 7.6 kb and a relative molecular mass of (2.6ཞ2.8)×10⁶, and contains three open reading frames (ORFs): ORF1 coding for non-structural proteins (NSPs), ORF2 coding for a capsid precursor that is posttranslationally processed to release the major capsid protein (VP1) and the leader of the capsid (LC) with 124 amino acids (aa) (Bhella and Goodfellow 2011; Glenn et al. 1999), and ORF3 coding for a minor capsid protein (VP2), respectively. The LC protein plays an important role in viral spread and can cause an activation of caspases and a cytopathic effect (CPE) in cell cultures (Abente et al. 2013). VP1 capsid protein has a functional role during the early replication of the calicivirus. The capsid precursor protein (LC-VP1) can further be divided into six regions, termed A to F. Regions B, D and F are more conserved, whereas regions A, C and E are variable. Region E contains two hypervariable regions that are separated by a conserved domain (Seal et al. 1993). The E region contains the major B cell epitopes and plays an important role in the formation of viral particle antigen structures. And conformational epitopes are probably more important than linear epitopes in viral neutralization (Radford et al. 2007; Sun et al. 2017). VP2 is essential for productive replication that results in the synthesis and maturation of infectious virions (Brunet et al. 2019; Sosnovtsev et al. 2005).

Since FCV was firstly isolated and identified in 1957, it has been distributed worldwide in all feline species, such as cats, tigers, lions, and cheetahs, with cats under one year old being the most susceptible (Kadoi et al. 1997; Radford et al. 1998). FCV infection is closely related to upper respiratory tract disease, acute mouth ulceration, and chronic stomatitis. Moreover, most infected or clinically recovered cats can persistently excrete the virus. During the widespread use of commercial vaccines, the cross-protection between the FCV wild strains and the live vaccine strain F9 has been gradually weakened (Smith et al. 2020), and immunization failure occurs frequently. Although existing vaccines can reduce clinical symptoms and virus excretion, they cannot prevent infection from occurring (Berger et al. 2015). Therefore, the persistent surveillance should be performed for the prevalence of FCV isolates and can provide an important insight into the development of novel vaccines. In recent years, there have been some reports of Chinese FCV strains, but few reports of FCV strains from the Chinese stray cats were reported (Guo et al. 2018; Sun et al. 2017). In view of the larger sphere of activity for stray cats, it is easier to spread viruses. So, the primary aim of this study was to isolate FCV strains from some stray cats in Shanghai, China and analyze their genomic and evolutionary characterization.

Sample description and DNA extraction

27 fecal samples were collected from the stray cats of Shanghai in September 2019. All samples were respectively homogenized in 1 mL of phosphate-buffered saline and centrifuged at 12,000 × g for 10 min. The clarified supernatant was filtered through 0.22 µm filters (Millipore). Viral RNA was then extracted from the clarified suspension using a TIANamp Virus DNA/RNA Kit (Tiangen, Beijing, China ) and reverse transcribed into cDNA using the FastQuant RT Kit (with gDNase) (Tiangen) according to the manufacturer’s instructions

Primer design and Polymerase Chain Reaction(PCR) amplification of FCV

Identification of viruses was performed by PCR using the highly specific primers (Table 1). The results showed three out of 27 samples were positive for FCV. And Crandell feline kidney (CRFK) cells were respectively inoculated with the positive supernatant at 37°C under 5% CO² in 25 cm² flasks. When more than 80% of cells show obvious cytopathic effect, cell suspension was collected and stored at -80°C until use. To amplify the complete genome of FCV, 7 pairs of specific primers (Table 1) were designed based on the conserved regions of the FCV genome sequences retrieved from NCBI. Reverse transcription PCR was performed in a 50 µL reaction mixture comprising 25 µL of Premix Taq (Takara Bio Inc., Shiga, Japan), 2 µL of each primer (10 µM), 2 µL of cDNA template, and 19 µL of ddH2O. The reaction conditions were as follows: initial denaturation at 95°C for 5 min;, 33 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 2 min; and a final elongation step of 72°C for 10min. In addition, the 3′ end of the genome was determined by using the method of rapid amplification of cDNA ends (RACE). The PCR products were visualized through electrophoresis on a 1% agarose gel and then purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme) per the manufacturer’s instructions. The purified amplicons were cloned into the pMD19-T vector (Takara) for subsequent sequencing (TSINGKE).

Table 1 Primers used for identification and PCR amplification of the complete genome of FCV.

Primer name	Nucleotide sequence(5’-3’)^a	Nt positions^b	Amplicon size(bp)
FCV-363-F FCV-363-R	ATTCGGARTGGGAGGCTTT GTRTCAGTRTCRGACATAAR	5808-6171	363
FCV-1F FCV-1R	GTAAAAGAAATTTGAGACAATGTCTC TTACCACATGTTGATTGGCGGGTA	1-2451	2451
FCV-2F FCV-2R	CTCCCCCTCCTACCTTTCTTAAC ATCTTTCCTGCCTGATCCCAATGCATGGGT	1987-5601	3614
FCV-3F FCV-3R	ATGTGCTCAACCTGCGCTAAC CCCTGGGGTTAGGCGCA	5321-7700	2380
FCV-3’UTR	AATTGAATTTAGCGGCCGCGAATTGGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

^aNucleotide sequences are shown using the single-letter IUB codes for degeneracy: R=A/G purine; Y=T/C pyrimidine; K=T/G.

^b The positions of primers were determined according to the complete genome sequence of FCV strain FCV-SH (GenBank accession no. KP987265)

Nucleotide sequences assemble and Sequence analysis

The obtained partial-genome sequences were sequenced at least three times and assembled using SeqMan Pro v. 7.1.0 (DNASTAR Inc.; Madison, WI, USA). And the assembled full-length genome sequence was analyzed using the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple sequence alignments were conducted between the sequence that we isolated and other referenced FCV isolates retrieved from NCBI database using Phylosuite v1.2.1. Pairwise sequence comparison was performed using the MegAlign program (DNASTAR Inc). Phylogenetic trees were constructed using the neighbor-joining method with 1,000 bootstraps replicates by MEGA6.06. Positive selection analysis of individual amino acid site was based on measuring the dN/dS ratio of the LC-VP1 gene using the Datamonkey online version (http://www.datamonkey.org/) (Poon et al. 2009). Four different codon -based maximum likelihood methods (SLAC, FEL, REL, FURBAR) and the mixed-effects model of evolution method (MEME) were used to estimate the selection pressure of mutated amino acid sites. To better understand the potential effect of LC-VP1 amino acid mutations on the protective efficiency of FCV vaccines B cell epitopes were predicted by using ABCpred (https://webs.iiitd.edu.in/raghava/abcpred/). Protein structure prediction and model editing on SWISS-MODEL(https://swissmodel.expasy.org/) and Pymol software respectively.

After three serial passages, a mutated strain of FCV, referred to as SH1909, was isolated from the fecal specimen of a stray cat. The full-length genome sequence of SH1909 consisted of 7770 nucleotides (nt) with a 5′-terminal untranslated region (UTR) of 19 nt and a 3′-terminal UTR of 123 nt. Three potential ORFs, including ORF1 (nt 20 to 5320), ORF2 (nt 5321 to 7342), and ORF3 (nt 7339 to 7646), were predicted within the genome of SH1909. The complete genome sequence of FCV strain SH1909 has been submitted to the GenBank database under accession number MW356260. Multiple sequence alignments were conducted between SH1909 and other referenced FCV isolates retrieved from NCBI database using Phylosuite v1.2.1. The results showed that NSPs of SH1909 shared 88.6%-95.8% and 88.0%-89.1% aa identities with those of other FCV field isolates from China and vaccine strains, respectively, and the highest aa identity (95.8%) with those of FB-NJ-13. As for the LC-VP1 capsid precursor of FCV, SH1909 shared 83.1%-89.2% and 82.2%-85.4% aa identities with the Chinese FCV isolates and vaccine strains, respectively, and the highest aa identity (89.2%) with HB-S4. The above results indicated that SH1909 has evolved significantly when compared with other FCV isolates and less similarity to the FCV vaccine strains than the field isolates.

Phylogenetic trees based on the complete aa sequences of LC-VP1. As shown in Fig. 1, all Chinese FCV isolates can be divided into different evolutionary branches based on the phylogenetic analysis of LC-VP1. However, some FCV isolates including SH1909 were clustered in a monophyletic clade, which was distantly related to the FCV vaccine strains, indicating the genotype diversity of FCV isolates and the potential of some Chinese endemic isolates including SH1909 to escape from immune response induced by vaccine.

Compared with other Chinese FCV isolates and vaccine strains, SH1909 possesses own unique aa mutation sites, involving seven aa mutations at sites 31 (E/D31K), 214 (K214R), 668 (C/H/N 668F), 751 (V/I751T),1139 (T/S 1139N), 1416 (E1416D) and 1728 (Y1728F) in the NSPs and six aa residue substitutions at positions 10 (K10T), 55 (N/D55K), 402 (K402R), 405 (I/T405Y), 439 (D/N/S/T439K), 497(N/K/T/S/T/E/Q497R) in LC-VP1. It is worth mentioning that aa substitutions at residues 439 and 497, which located in the N-terminal half and C-terminal half parts of region E respectively, may affect the formation of the antigenic structure of the virus particles. In addition, SH1909, similar to CH-JL4 and TIG-1, possesses an insertion of an Asparagine at site 495 of LC-VP1, whereas the deletion of a Tyrosine locates at site 1034 of NSPs regions in CH-JL4 and TIG-1.Positive selection analysis of individual amino acid site. We found the amino acid residues at sites 449 and 493 were supported by more than one method, with P-values < 0.05. In B cell epitopes predicted, four peptides, ranked top three in score, were selected as possible B cell epitopes for analysis (peptide A: sites 247–262, peptide B: sites 218–233, peptide C: sites 445–460, peptide D: sites 425–440). Four B cell epitopes were all displayed on the structural surface of VP1 protein (Fig. 2). According to the alignment of amino acid sequences, it showed that peptides A and B were located in the conserved N-terminal of VP1, whereas peptides C and D were displayed in its hypervariable C-terminal(Fig. 3). Specific amino acid mutation site 439 and the positive selection site 449 for SH1909 was included in the peptides D and C, respectively. These results indicated that amino acid mutations with high frequency in the predicted B cell epitopes (peptide C and D) may weaken the capacity of the cross-protection of vaccine. Moreover, the mutations at amino acid sites 439 and 449 may be closely related with SH1909 escaping from the immune response to FCV vaccine.

In conclusion, the complete genome sequence of a FCV strain SH1909 from a stray cat in China, was determined in this study. Phylogenetic analysis revealed that SH1909 was clustered into an independent evolutionary branch with some Chinese isolates and possessed the potential to escape from vaccine-elicited immunity. Sequence comparison and analysis showed that thirteen unique aa residues substitutions and single-aa insertion of N or Y were respectively observed in ORF1 and ORF2 of SH1909, which indicated that SH1909 was a novel and natural mutant of FCV. In addition, two (peptides C and D) out of four predicted B cell epitopes, located in the hypervariable regions of VP1, may result in the decreased immunological protection. Moreover, two specific mutation sites 439 and 449 may be closely related with SH1909 escaping from the immune response to FCV vaccine. These results will provide an important insight into genetic variations involved in viral evolution and a reference for design of future FCV vaccines.

Acknowledgements

Thank you to Shanghai Pet Field Pet Hospital for providing us with stray cat faeces. We thank our laboratory director Dr Liu Guangqing and our supervisor Dr Li Chuanfeng for allowing us to carry out our research.

Funding This study was funded by the Shanghai Science and Technology Promotion Agriculture Innovation Program (2019No.3-3) and the National Key Research and Development Program of China (No. 2016YFD0501003).

Data availability All data generated or analyzed during this study are included in this published article.

Ethics declarations No experimental work with animals or humans was done in this study.

Consent to Participate All authors participated voluntarily in the research.

Consent to publish All authors read and approved the manuscript.

Conflict of interests The authors declare no conflict of interest.

Abente EJ, Sosnovtsev SV, Sandoval-Jaime C, Parra GI, Bok K, Green KY (2013) The feline calicivirus leader of the capsid protein is associated with cytopathic effect. J Virol 87(6):3003–3017
Berger A, Willi B, Meli ML, Boretti FS, Hartnack S, Dreyfus A, Lutz H, Hofmann-Lehmann R (2015) Feline calicivirus and other respiratory pathogens in cats with Feline calicivirus-related symptoms and in clinically healthy cats in Switzerland. BMC Vet Res 11:282
Bhella D, Goodfellow IG (2011) The cryo-electron microscopy structure of feline calicivirus bound to junctional adhesion molecule A at 9-angstrom resolution reveals receptor-induced flexibility and two distinct conformational changes in the capsid protein VP1. J Virol 85(21):11381–11390
Brunet S, Sigoillot-Claude C, Pialot D, Poulet H (2019) Multiple Correspondence Analysis on Amino Acid Properties within the Variable Region of the Capsid Protein Shows Differences between Classical and Virulent Systemic Feline Calicivirus Strains. Viruses 11(12)
Glenn M, Radford AD, Turner PC, Carter M, Lowery D, DeSilver DA, Meanger J, Baulch-Brown C, Bennett M, Gaskell RM (1999) Nucleotide sequence of UK and Australian isolates of feline calicivirus (FCV) and phylogenetic analysis of FCVs. Vet Microbiol 67(3):175–193
Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Matson DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ (2000) Taxonomy of the caliciviruses. J Infect Dis 181(Suppl 2):S322–S330
Guo H, Miao Q, Zhu J, Yang Z, Liu G (2018) Isolation and molecular characterization of a virulent systemic feline calicivirus isolated in China. Infect Genet Evol 65:425–429
Kadoi K, Kiryu M, Iwabuchi M, Kamata H, Yukawa M, Inaba Y (1997) A strain of calicivirus isolated from lions with vesicular lesions on tongue and snout. New Microbiol 20(2):141–148
Kosakovsky Pond SL, Frost SDW (2005) Not so different after all: a comparison of methods for detecting amino acid sites under selection. Mol Biol Evol 22(5):1208–1222
Radford AD, Coyne KP, Dawson S, Porter CJ, Gaskell RM (2007) Feline calicivirus. Vet Res 38(2):319–335
Radford AD, Turner PC, Bennett M, McArdle F, Dawson S, Glenn MA, Williams RA, Gaskell RM (1998) Quasispecies evolution of a hypervariable region of the feline calicivirus capsid gene in cell culture and in persistently infected cats. J Gen Virol 79 (Pt 1)
Seal BS, Ridpath JF, Mengeling WL (1993) Analysis of feline calicivirus capsid protein genes: identification of variable antigenic determinant regions of the protein. J Gen Virol 74(Pt 11):2519–2524
Smith SL, Afonso MM, Pinchbeck GL, Gaskell RM, Dawson S, Radford AD (2020) Temporally separated feline calicivirus isolates do not cluster phylogenetically and are similarly neutralised by high-titre vaccine strain FCV-F9 antisera in vitro. J Feline Med Surg 22(6):602–607
Sosnovtsev SV, Belliot G, Chang K-O, Onwudiwe O, Green KY (2005) Feline calicivirus VP2 is essential for the production of infectious virions. J Virol 79(7):4012–4024
Sun Y, Deng M, Peng Z, Hu R, Chen H, Wu B (2017) Genetic and phylogenetic analysis of feline calicivirus isolates in China. Vet J 220:24–27
Tohya Y, Masuoka K, Takahashi E, Mikami T (1991) Neutralizing epitopes of feline calicivirus. Arch Virol 117(3–4):173–181

Download PDF

Reviews received at journal
10 Sep, 2021
Reviewers invited by journal
04 Sep, 2021
Editor assigned by journal
02 Sep, 2021
First submitted to journal
31 Aug, 2021

You are reading this latest preprint version

Molecular Characterization of a Natural Mutant of Feline Calicivirus in China

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Sample description and DNA extraction

Primer design and Polymerase Chain Reaction(PCR) amplification of FCV

Nucleotide sequences assemble and Sequence analysis

Results And Discussion

Conclusion

Declarations

Consent to Participate All authors participated voluntarily in the research.

References

Status:

Version 1